diff --git a/.DS_Store b/.DS_Store
new file mode 100644
index 00000000..6bbe1d35
Binary files /dev/null and b/.DS_Store differ
diff --git a/.Rhistory b/.Rhistory
new file mode 100644
index 00000000..e69de29b
diff --git a/README.md b/README.md
index e2ced9a6..49fa6a4e 100644
--- a/README.md
+++ b/README.md
@@ -1,14 +1,7 @@
-# STMO-ZOO
+# RNAfolder
 
-Welcome to the STMO zoo! This is your final assignment for the course Selected Topics in Mathematical Optimization. Your goal is to implement an optimization method in Julia and contribute this to this repository. To pass, you have to:
+Menno Van Damme
 
-- fork this repo and create a pull request;
-- add a module to `src` with **at least one function**
-- add at least one unit test to the folder `test`;
-- document all your functions and add a page to the documentation page;
-- make a notebook in [Pluto](https://github.com/fonsp/Pluto.jl) and add it to `notebooks`;
-- perform a small code review of two other students.
-
-Depending on the project you choose some of these individual assignments might be really minimalistic, with other parts larger. For example, if you want to develop an application, say solving the graph coloring problem with Tabu Search, you might have only a single function in the source code (e.g., generating an instance) but have a fairly large notebook with a tutorial. On the other hand, if you work on a method, e.g., implementing Bee Colony Optimization, you might have many functions in the source code, while your notebook is only a demonstration on the test functions. 
+RNAfolder is a Julia tool to predict the secondary structure of RNA sequences using dynamic programming.
 
 [![Build Status](https://travis-ci.org/MichielStock/STMOZOO.svg?branch=master)](https://travis-ci.org/MichielStock/STMOZOO)[![Coverage Status](https://coveralls.io/repos/github/MichielStock/STMOZOO/badge.svg?branch=master)](https://coveralls.io/github/MichielStock/STMOZOO?branch=master)
\ No newline at end of file
diff --git a/notebook/RNAfolder.jl b/notebook/RNAfolder.jl
new file mode 100644
index 00000000..510e0250
--- /dev/null
+++ b/notebook/RNAfolder.jl
@@ -0,0 +1,1724 @@
+### A Pluto.jl notebook ###
+# v0.17.1
+
+using Markdown
+using InteractiveUtils
+
+# This Pluto notebook uses @bind for interactivity. When running this notebook outside of Pluto, the following 'mock version' of @bind gives bound variables a default value (instead of an error).
+macro bind(def, element)
+    quote
+        local iv = try Base.loaded_modules[Base.PkgId(Base.UUID("6e696c72-6542-2067-7265-42206c756150"), "AbstractPlutoDingetjes")].Bonds.initial_value catch; b -> missing; end
+        local el = $(esc(element))
+        global $(esc(def)) = Core.applicable(Base.get, el) ? Base.get(el) : iv(el)
+        el
+    end
+end
+
+# ╔═╡ dba46e66-8704-42de-938c-d576a1336398
+using PlutoUI, Plots, Graphs, GraphMakie, CairoMakie, NetworkLayout, Test
+
+# ╔═╡ 4b3e86ea-6973-11ec-014f-9f2708ba86cf
+md"""
+
+# RNAfolder
+
+*STMO*
+
+**Menno Van Damme**
+
+This pluto notebook contains the code for a simple RNA secondary structure prediction tool.
+
+## Nussinov's Algorithm
+
+The tool uses an algorithm called Nussinov's algorithm. This is a basepair maximization algorithm, it predicts the optimal structure by trying to maximize the amount of paired nucleotides in an RNA sequence. This was one of the first ever algorithms to be used in RNA folding but sadly this algorithm is often too simple to get realistic results. 
+
+Other algorithms like energy minimization algorithms try to achieve the same thing but do this by taking base pairing energies, the energies of stacking of certain types of basepairs and the sizes of different structures into account and by calculating the total minimum free energy of the folded RNA. However, implementeing these is a lot more complicated and out of the scope of a project like this.
+
+Nussinov's algorithm tries to maximize the amount of paired bases in the structure. It does this using the following formula:
+
+$$S(i,j) = \max_{i\leq k<j} \begin{cases} S(i,j-1) \qquad\qquad\qquad\qquad\qquad\quad\; \text{if i unpaired} \\S(i,k-1)+S(k+1,j-1)+1 \qquad \text{if i, k complementary} \end{cases}$$
+
+Here $$i$$, $$j$$, and $$k$$ are three positions in the RNA sequence with $$k$$ being equal to $$i$$ or in between $$i$$ and $$j$$. And $$S(i,j)$$ is the score of the subsequence from $$i$$ to $$j$$ given by the aglorithm, this score is equal to the amount of basepairs in the subsequence.
+
+This formula is used to recursively fill in a dynamic programming matrix $$(S)$$ starting from smaller distances between $$i$$ and $$j$$ to larger ones, thus from smaller to larger subsequences, until $$i = 1$$ and $$j = n$$ (the length of the sequence). $$S(1,n)$$ then represents the score of the entire sequence.
+
+If position $$j$$ is not paired to any nucleotide, the score does not change. So the score remains the same as the score of the subsequence one nucleotide smaller $$S(i,j-1)$$. If $$j$$ can basepair with a nucleotide $$k$$ in the range $$i:j-1$$ then the sequence is split into two subsequence $$i...k-1$$ and $$k+1...j-1$$, if we add their scores together with a $$+1$$ for the new basepair $$(k,j)$$ we get the score of the entire subsequence. if $$k=i$$ than we have a special case where $$S(i,k-1)=S(i,i-1)$$ this is why $$S(i,i-1)$$ is set to be equal to zero.
+
+The matrix $$S$$ is initialized by all zeros and new values are only added to the upper right side of the matrix. Note that for two nucleotides to be able to basepair at least three other nucleotides need to be between them, otherwise there is not enough space for them to pair.
+
+Below you can see the implementation for this algorithm.
+
+"""
+
+# ╔═╡ d3ee4413-c691-4fba-9f91-f24985fb8a88
+md""" The Nussinov matrix for the example RNA looks like this: """
+
+# ╔═╡ a455cfa0-ee29-4a4e-8b26-cf91c36985ec
+md"""
+
+To retrieve the basepairs which form the optimally scoring secondary structure we have to perform a backtracking procedure. This procedure starts in the upper right corner of the dynamic programming matrix where $$i=1$$ and $$j=n$$ and continues towards smaller subsequences. If $$S(i,j)$$ is equal to $$S(i,j-1)$$ we can say that $$j$$ is unpaired and we can continue the traceback from $$(i,j-1)$$. Else $$j$$ is paired to a $$k$$. If $$k=i$$ then $$S(i,j)=S(i+1,j-1)+1$$ and we can continue the traceback from $$(i+1,j-1)$$. If $$k \neq i$$ then $$S(i,j)=S(i,k-1)+S(i+1,j-1)+1$$ and the traceback splits up in the two substructures that were formed $$(i,k-1)$$ and $$(k+1,j-1)$$.
+
+Since the rules of the Nussinov algorithm are simple there are most of the time many roads that lead to the same optimal score for a structure and thus many optimal ways to fold the RNA. This is because score for pairing $$j$$ with $$i$$ might give you the same score as pairing $$j$$ with $$k \; (\neq i)$$ or even the same as leaving $$j$$ unpaired.
+"""
+
+# ╔═╡ aea52dd9-7bcc-4873-9332-36b95592b27b
+md""" If we backtrack from $$(i=1,j=n)$$ we get all the pairs in the sequence: """
+
+# ╔═╡ 31aeff3d-5083-4c26-a556-847fbe76f9d6
+md"""
+
+## Tool
+
+"""
+
+# ╔═╡ b2084e43-7914-495f-b93e-cf56a87be3c7
+md"""
+
+You can either choose an example sequence or input you own (DNA sequences are also allowed).
+
+"""
+
+# ╔═╡ 59108cf2-d8a5-4c16-b373-bb6a23d13735
+begin
+	choices = ["Choose an example sequence:", "Input your own sequence:"]
+	@bind choice Radio(choices, default = choices[1])
+end
+
+# ╔═╡ ed0a3dc5-99d3-4628-ad5c-7d13e699b353
+begin
+	RNAs = ["GGGAAUAUUAUAUCC" => "Example 1 (15 nucleotides)", 
+			"GGGCACUUGACUCGAGCAGACCGUAGCGAUAGCGCGAGAUUUGCCGGACUACCAC" => "Example 2 (55 nucleotides)", "GCTCGTGCGTCGATGAACAACGCAGCTAGCTGCGAGAATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTTGAAAAAAAAAAAAAAAAAAAAAA" => "Human 5.8S rRNA (156 nucleotides)",
+"ATGGACTCCAACACTGTGTCAAGCTTTCAGGTAGACTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAGAACTGGGTGATGCCCCATTCCTTGACCGGCTTCGCCGAGACCAGAAGTCCCTAAGAGGAAGAGGCAGCACTCTTGGTCTGGACATCGAGACAGCTACTCGTGCGGGAAAGCAAATAGTGGAGCGGATTCTGGGGGAAGAATCTGATGAAGCACTTAAAATGAATATTGCTTCTGTACCGACTTCACGCTACCTAACTGACATGACTCTTGAAGAAATGTCAAGAGACTGGTTCATGCTCATGCCCAAGCAGAAAGTAGCAGGTTCTCTCTGCATCAAAATGGACCAGGCAATAATGGATAAAACCATCATACTGAAAGCAAATTTCAGTGTGATTTTTGATCGGCTGGAAACCCTAATATTACTTAGAGCTTTCACAGAAGAAGGAGCAATTGTGGGAGAAATCTCACCATTACCTTCTCTTCCAGGACATACTGATGAGGATGTCAAAATTGCAATTGGGGTCCTCATCGGAGGGCTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCACTTGGAGAAGCAGTAATGAGGATGGGAGACCTTCACTCCCTTCAAAACAGAAACGGAAAATGGCGAGAACAATTGAGTCAGAAGTTCGAGGAAATAAGATGGCTGATTGAGGAAATGCGACATAGATTGAAGACCACAGAGAACAGCTTCGAACAAATAACGTTTATGCAAGCTTTACAACTATTGCTTGAAGTGGAGCAAGAGATAAGAACCTTCTCGTTTCAGCTTATTTAA" => "Influenza A NS protein gene (838 nucleotides)"]
+	
+	if choice == choices[1]
+		@bind rna Radio(RNAs, default = RNAs[1][1])
+	elseif choice == choices[2]
+		@bind rna TextField()
+	end
+end
+
+# ╔═╡ 3c7f1384-33ac-4b2d-9a63-4bf412bfa685
+RNA = replace(uppercase(rna), 'T' => 'U')
+
+# ╔═╡ 45b4e0ec-5581-4a28-b6c1-c95b8e6a42bb
+RNA
+
+# ╔═╡ 42921538-4ff4-4902-aefa-d958f41d1404
+md"""
+
+Below you can see the dotbracket strucure of the RNA. This is a representation of the secondary structure by using dots and brackets. Each character represents a nucleotide in the sequence. Opening and closing brackets indicate two nucleotides that basepair. Dots represent unpaired nucleotides. Since guanine (G) and uracil (U) can also pair in RNA, GU pairs are allowed.
+
+"""
+
+# ╔═╡ fd14341c-f195-4b86-9f9c-379477eed4af
+md"""
+
+Here is the visualization of the secondary structure:
+
+"""
+
+# ╔═╡ ca99ac1a-e4da-41fe-8ab6-834e2b7134b7
+md"""
+
+Sadly there are no RNA visualization packages for Julia so I've had to use graph visualization libraries, these aren't ideal for this task so the structure might not look entirely correct. If you want a better view of the structure you can copy the following link. It will take you to a ViennaRNA webpage especially designed for displaying secondary RNA structures based on the sequence and dotbracket structure embedded in the link.
+
+"""
+
+# ╔═╡ 2fbe430d-ab80-406e-aa87-c377d6ed30c2
+md"""
+
+## Appendix
+
+"""
+
+# ╔═╡ e5650185-a6bc-488c-a02b-3c1363c52b8c
+"""
+	basepair(i, j, RNA)
+
+Returns a the logical true if 2 nucleotides can basepair, else false.
+
+"""
+function basepair(i, j, RNA)
+	pair = string(RNA[i], RNA[j])
+	# all possible pairs (GU is also possible in RNA):
+	pairs = ["AU", "UA", "GC", "CG", "UG", "GU"]
+	if pair in pairs
+		return true
+	else
+		return false
+	end
+end
+
+# ╔═╡ 2d83c447-1d33-496a-8a39-75d1cb9b2de1
+"""
+	Nussinov(RNA)
+
+Returns the Nussinov dynamic programming matrix of the RNA sequence.
+
+"""
+function Nussinov(RNA)
+	n = length(RNA)
+	S = zeros(n,n)
+	# recursion happens from smaller to larger distancs between i and j,
+	# from the diagonal towards the upper right corner in the matrix
+	for d in 4:n-1 # at least 3 other nucleotides between a bp
+		for i in 1:n-d
+			j = i + d
+			# j doesn't basepair
+			nobp_score = S[i,j-1]
+			# j basepairs with i (same as with k but S[i,k-1] = 0)
+			if basepair(i,j,RNA)
+				bpi_score = S[i+1,j-1] + 1
+			else
+				bpi_score = 0
+			end
+			# j basepairs with k in the range [i+1:j-4]
+			bpk = []
+			for k in i+1:j-4 # at least 3 other nucleotides between a bp
+				if basepair(k,j,RNA)
+					push!(bpk, S[i,k-1] + S[k+1,j-1] + 1)
+				end
+			end
+			if !isempty(bpk)
+				bpk_score = maximum(bpk)
+			else
+				bpk_score = 0
+			end
+			# the actual score is the maximum of these scores
+			S[i,j] = max(nobp_score, bpi_score, bpk_score)
+		end
+	end
+	return S
+end
+
+# ╔═╡ 0a20eddd-24f7-43c6-a0f3-6c1c138fb90a
+S = Nussinov(RNA)
+
+# ╔═╡ 463d18c3-e155-4b73-896f-2bbcdb71bbd2
+"""
+	traceback(RNA, S, i, j; pairs = [])
+
+Performs a backtracking through the Nussinov dynamic programming matrix starting from position (i,j). Outputs a list of tuples with all the pairs in the sequence.
+
+"""
+function traceback(RNA, S, i, j; pairs = [])
+	if i < j
+		if  S[i,j] == S[i,j-1] 
+			traceback(RNA, S, i, j-1, pairs = pairs)
+		elseif S[i,j] == S[i+1,j-1] + 1 && basepair(i, j, RNA)
+			push!(pairs, (i,j))
+			traceback(RNA, S, i+1, j-1, pairs = pairs)
+		else
+			for k in i+1:j-4
+				if S[i,j] == S[i,k-1] + S[k+1,j-1] + 1 && basepair(k, j, RNA)
+					push!(pairs, (k,j))
+					traceback(RNA, S, i, k-1, pairs = pairs)
+					traceback(RNA, S, k+1, j-1, pairs = pairs)
+					break
+				end
+			end
+		end
+	end
+	return pairs
+end
+
+# ╔═╡ 43f97b8d-cd9c-4b8f-8821-68542488e49d
+pairs = traceback(RNA, S, 1, length(RNA))
+
+# ╔═╡ b156a4c7-6ed9-4a4d-b3c9-d3c06fbc1faf
+"""
+	dotbracket(RNA, pairs)
+
+Returns the dotbracket structure of the RNA, given a list of pairs.
+
+"""
+function dotbracket(RNA, pairs)
+	n = length(RNA)
+	db = collect('.' ^ n)
+	for (i,j) in pairs
+		db[i] = '('
+		db[j] = ')'
+	end
+	db = join(db)
+	return db
+end
+
+# ╔═╡ f66956d6-6d0d-42d1-b210-4bdf23ccd0b8
+structure = dotbracket(RNA, pairs)
+
+# ╔═╡ c86cc53d-4675-4cd1-af75-ec4a717fd7fa
+link = "http://nibiru.tbi.univie.ac.at/forna/forna.html?id=url/name&sequence=$RNA&structure=$structure"
+
+# ╔═╡ e25d53b9-0096-4b6c-85cb-fcae261fabcb
+md""" $link """
+
+# ╔═╡ f4e866fc-8e18-4917-b515-9cc00175a7a4
+begin
+	myblue = "#304da5"
+	mygreen = "#2a9d8f"
+	myyellow = "#e9c46a"
+	myred = "#e76f51"
+end
+
+# ╔═╡ 2e8fb274-0658-43f8-bfa0-40f2f1daf6f3
+"""
+	plotstructure(RNA, pairs)
+
+Plots the secondary structure of the RNA, given a list of pairs.
+
+"""
+function plotstructure(RNA, pairs)
+	n = length(RNA)
+	edges = [(i,i+1) for i in 1:n-1]
+	append!(edges, pairs)
+	G = SimpleGraph(Edge.(edges))
+	colors = [mygreen, myblue, myyellow, myred]
+	members = replace(collect(RNA), 'A' => 1, 'U' => 2, 'G' => 3, 'C' => 4)
+	nodecolors = colors[members]
+	edgecolors = []
+	for edge in sort(edges)
+		if edge in pairs
+			push!(edgecolors, :red)
+		else
+			push!(edgecolors, :black)
+		end
+	end
+	nuc = [string(i) for i in RNA]
+	nodesize = 1000/n
+	edgewidth = nodesize/3
+	f, ax, p = graphplot(G,
+						layout = Stress(),
+						node_size = nodesize,
+						node_color = nodecolors,
+						edge_color = edgecolors,
+						edge_width = edgewidth,
+						nlabels = nuc,
+						nlabels_align = (:center,:center),
+						nlabels_textsize = nodesize,
+						)
+	hidedecorations!(ax); hidespines!(ax)
+	ax.aspect = DataAspect()
+	return f	
+end
+
+# ╔═╡ 06983a7b-efca-4167-be5d-a158a4e0858d
+plotstructure(RNA, pairs)
+
+# ╔═╡ 94691ccf-b1ef-4cc3-8eed-72dd543001f5
+md""" Unit tests are in the hidden chunk below: """
+
+# ╔═╡ 32755c53-eefc-4d40-bf60-a8b21a545c6d
+@testset "RNAfolder" begin
+	
+	@testset "Nussinov" begin
+		
+		@test Nussinov("AGCU") isa Array
+		@test Nussinov("AAA") == zeros(3,3)
+		@test Nussinov("AGCU") == zeros(4,4)
+		@test Nussinov("AAAAU")[1,5] == 1.0
+		
+	end
+	
+	@testset "Traceback" begin
+		
+		@test traceback("AAA", Nussinov("AAA"), 1, 3) isa Array
+		@test isempty(traceback("AAA", Nussinov("AAA"), 1, 3))
+		@test traceback("AAAAU", Nussinov("AAAAU"), 1, 5) == [(1,5)]
+		
+	end
+		
+end
+
+# ╔═╡ 00000000-0000-0000-0000-000000000001
+PLUTO_PROJECT_TOML_CONTENTS = """
+[deps]
+CairoMakie = "13f3f980-e62b-5c42-98c6-ff1f3baf88f0"
+GraphMakie = "1ecd5474-83a3-4783-bb4f-06765db800d2"
+Graphs = "86223c79-3864-5bf0-83f7-82e725a168b6"
+NetworkLayout = "46757867-2c16-5918-afeb-47bfcb05e46a"
+Plots = "91a5bcdd-55d7-5caf-9e0b-520d859cae80"
+PlutoUI = "7f904dfe-b85e-4ff6-b463-dae2292396a8"
+Test = "8dfed614-e22c-5e08-85e1-65c5234f0b40"
+
+[compat]
+CairoMakie = "~0.6.6"
+GraphMakie = "~0.3.1"
+Graphs = "~1.5.1"
+NetworkLayout = "~0.4.4"
+Plots = "~1.25.6"
+PlutoUI = "~0.7.23"
+"""
+
+# ╔═╡ 00000000-0000-0000-0000-000000000002
+PLUTO_MANIFEST_TOML_CONTENTS = """
+# This file is machine-generated - editing it directly is not advised
+
+[[AbstractFFTs]]
+deps = ["ChainRulesCore", "LinearAlgebra"]
+git-tree-sha1 = "6f1d9bc1c08f9f4a8fa92e3ea3cb50153a1b40d4"
+uuid = "621f4979-c628-5d54-868e-fcf4e3e8185c"
+version = "1.1.0"
+
+[[AbstractPlutoDingetjes]]
+deps = ["Pkg"]
+git-tree-sha1 = "8eaf9f1b4921132a4cff3f36a1d9ba923b14a481"
+uuid = "6e696c72-6542-2067-7265-42206c756150"
+version = "1.1.4"
+
+[[AbstractTrees]]
+git-tree-sha1 = "03e0550477d86222521d254b741d470ba17ea0b5"
+uuid = "1520ce14-60c1-5f80-bbc7-55ef81b5835c"
+version = "0.3.4"
+
+[[Adapt]]
+deps = ["LinearAlgebra"]
+git-tree-sha1 = "af92965fb30777147966f58acb05da51c5616b5f"
+uuid = "79e6a3ab-5dfb-504d-930d-738a2a938a0e"
+version = "3.3.3"
+
+[[Animations]]
+deps = ["Colors"]
+git-tree-sha1 = "e81c509d2c8e49592413bfb0bb3b08150056c79d"
+uuid = "27a7e980-b3e6-11e9-2bcd-0b925532e340"
+version = "0.4.1"
+
+[[ArgTools]]
+uuid = "0dad84c5-d112-42e6-8d28-ef12dabb789f"
+
+[[ArnoldiMethod]]
+deps = ["LinearAlgebra", "Random", "StaticArrays"]
+git-tree-sha1 = "f87e559f87a45bece9c9ed97458d3afe98b1ebb9"
+uuid = "ec485272-7323-5ecc-a04f-4719b315124d"
+version = "0.1.0"
+
+[[ArrayInterface]]
+deps = ["Compat", "IfElse", "LinearAlgebra", "Requires", "SparseArrays", "Static"]
+git-tree-sha1 = "ffc6588e17bcfcaa79dfa5b4f417025e755f83fc"
+uuid = "4fba245c-0d91-5ea0-9b3e-6abc04ee57a9"
+version = "4.0.1"
+
+[[Artifacts]]
+uuid = "56f22d72-fd6d-98f1-02f0-08ddc0907c33"
+
+[[Automa]]
+deps = ["Printf", "ScanByte", "TranscodingStreams"]
+git-tree-sha1 = "d50976f217489ce799e366d9561d56a98a30d7fe"
+uuid = "67c07d97-cdcb-5c2c-af73-a7f9c32a568b"
+version = "0.8.2"
+
+[[AxisAlgorithms]]
+deps = ["LinearAlgebra", "Random", "SparseArrays", "WoodburyMatrices"]
+git-tree-sha1 = "66771c8d21c8ff5e3a93379480a2307ac36863f7"
+uuid = "13072b0f-2c55-5437-9ae7-d433b7a33950"
+version = "1.0.1"
+
+[[Base64]]
+uuid = "2a0f44e3-6c83-55bd-87e4-b1978d98bd5f"
+
+[[Bzip2_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "19a35467a82e236ff51bc17a3a44b69ef35185a2"
+uuid = "6e34b625-4abd-537c-b88f-471c36dfa7a0"
+version = "1.0.8+0"
+
+[[CEnum]]
+git-tree-sha1 = "215a9aa4a1f23fbd05b92769fdd62559488d70e9"
+uuid = "fa961155-64e5-5f13-b03f-caf6b980ea82"
+version = "0.4.1"
+
+[[Cairo]]
+deps = ["Cairo_jll", "Colors", "Glib_jll", "Graphics", "Libdl", "Pango_jll"]
+git-tree-sha1 = "d0b3f8b4ad16cb0a2988c6788646a5e6a17b6b1b"
+uuid = "159f3aea-2a34-519c-b102-8c37f9878175"
+version = "1.0.5"
+
+[[CairoMakie]]
+deps = ["Base64", "Cairo", "Colors", "FFTW", "FileIO", "FreeType", "GeometryBasics", "LinearAlgebra", "Makie", "SHA", "StaticArrays"]
+git-tree-sha1 = "774ff1cce3ae930af3948c120c15eeb96c886c33"
+uuid = "13f3f980-e62b-5c42-98c6-ff1f3baf88f0"
+version = "0.6.6"
+
+[[Cairo_jll]]
+deps = ["Artifacts", "Bzip2_jll", "Fontconfig_jll", "FreeType2_jll", "Glib_jll", "JLLWrappers", "LZO_jll", "Libdl", "Pixman_jll", "Pkg", "Xorg_libXext_jll", "Xorg_libXrender_jll", "Zlib_jll", "libpng_jll"]
+git-tree-sha1 = "4b859a208b2397a7a623a03449e4636bdb17bcf2"
+uuid = "83423d85-b0ee-5818-9007-b63ccbeb887a"
+version = "1.16.1+1"
+
+[[ChainRulesCore]]
+deps = ["Compat", "LinearAlgebra", "SparseArrays"]
+git-tree-sha1 = "54fc4400de6e5c3e27be6047da2ef6ba355511f8"
+uuid = "d360d2e6-b24c-11e9-a2a3-2a2ae2dbcce4"
+version = "1.11.6"
+
+[[ChangesOfVariables]]
+deps = ["ChainRulesCore", "LinearAlgebra", "Test"]
+git-tree-sha1 = "bf98fa45a0a4cee295de98d4c1462be26345b9a1"
+uuid = "9e997f8a-9a97-42d5-a9f1-ce6bfc15e2c0"
+version = "0.1.2"
+
+[[ColorBrewer]]
+deps = ["Colors", "JSON", "Test"]
+git-tree-sha1 = "61c5334f33d91e570e1d0c3eb5465835242582c4"
+uuid = "a2cac450-b92f-5266-8821-25eda20663c8"
+version = "0.4.0"
+
+[[ColorSchemes]]
+deps = ["ColorTypes", "Colors", "FixedPointNumbers", "Random"]
+git-tree-sha1 = "6b6f04f93710c71550ec7e16b650c1b9a612d0b6"
+uuid = "35d6a980-a343-548e-a6ea-1d62b119f2f4"
+version = "3.16.0"
+
+[[ColorTypes]]
+deps = ["FixedPointNumbers", "Random"]
+git-tree-sha1 = "32a2b8af383f11cbb65803883837a149d10dfe8a"
+uuid = "3da002f7-5984-5a60-b8a6-cbb66c0b333f"
+version = "0.10.12"
+
+[[ColorVectorSpace]]
+deps = ["ColorTypes", "FixedPointNumbers", "LinearAlgebra", "SpecialFunctions", "Statistics", "TensorCore"]
+git-tree-sha1 = "3f1f500312161f1ae067abe07d13b40f78f32e07"
+uuid = "c3611d14-8923-5661-9e6a-0046d554d3a4"
+version = "0.9.8"
+
+[[Colors]]
+deps = ["ColorTypes", "FixedPointNumbers", "Reexport"]
+git-tree-sha1 = "417b0ed7b8b838aa6ca0a87aadf1bb9eb111ce40"
+uuid = "5ae59095-9a9b-59fe-a467-6f913c188581"
+version = "0.12.8"
+
+[[Compat]]
+deps = ["Base64", "Dates", "DelimitedFiles", "Distributed", "InteractiveUtils", "LibGit2", "Libdl", "LinearAlgebra", "Markdown", "Mmap", "Pkg", "Printf", "REPL", "Random", "SHA", "Serialization", "SharedArrays", "Sockets", "SparseArrays", "Statistics", "Test", "UUIDs", "Unicode"]
+git-tree-sha1 = "44c37b4636bc54afac5c574d2d02b625349d6582"
+uuid = "34da2185-b29b-5c13-b0c7-acf172513d20"
+version = "3.41.0"
+
+[[CompilerSupportLibraries_jll]]
+deps = ["Artifacts", "Libdl"]
+uuid = "e66e0078-7015-5450-92f7-15fbd957f2ae"
+
+[[Contour]]
+deps = ["StaticArrays"]
+git-tree-sha1 = "9f02045d934dc030edad45944ea80dbd1f0ebea7"
+uuid = "d38c429a-6771-53c6-b99e-75d170b6e991"
+version = "0.5.7"
+
+[[DataAPI]]
+git-tree-sha1 = "cc70b17275652eb47bc9e5f81635981f13cea5c8"
+uuid = "9a962f9c-6df0-11e9-0e5d-c546b8b5ee8a"
+version = "1.9.0"
+
+[[DataStructures]]
+deps = ["Compat", "InteractiveUtils", "OrderedCollections"]
+git-tree-sha1 = "3daef5523dd2e769dad2365274f760ff5f282c7d"
+uuid = "864edb3b-99cc-5e75-8d2d-829cb0a9cfe8"
+version = "0.18.11"
+
+[[DataValueInterfaces]]
+git-tree-sha1 = "bfc1187b79289637fa0ef6d4436ebdfe6905cbd6"
+uuid = "e2d170a0-9d28-54be-80f0-106bbe20a464"
+version = "1.0.0"
+
+[[Dates]]
+deps = ["Printf"]
+uuid = "ade2ca70-3891-5945-98fb-dc099432e06a"
+
+[[DelimitedFiles]]
+deps = ["Mmap"]
+uuid = "8bb1440f-4735-579b-a4ab-409b98df4dab"
+
+[[DensityInterface]]
+deps = ["InverseFunctions", "Test"]
+git-tree-sha1 = "80c3e8639e3353e5d2912fb3a1916b8455e2494b"
+uuid = "b429d917-457f-4dbc-8f4c-0cc954292b1d"
+version = "0.4.0"
+
+[[Distributed]]
+deps = ["Random", "Serialization", "Sockets"]
+uuid = "8ba89e20-285c-5b6f-9357-94700520ee1b"
+
+[[Distributions]]
+deps = ["ChainRulesCore", "DensityInterface", "FillArrays", "LinearAlgebra", "PDMats", "Printf", "QuadGK", "Random", "SparseArrays", "SpecialFunctions", "Statistics", "StatsBase", "StatsFuns", "Test"]
+git-tree-sha1 = "5863b0b10512ed4add2b5ec07e335dc6121065a5"
+uuid = "31c24e10-a181-5473-b8eb-7969acd0382f"
+version = "0.25.41"
+
+[[DocStringExtensions]]
+deps = ["LibGit2"]
+git-tree-sha1 = "b19534d1895d702889b219c382a6e18010797f0b"
+uuid = "ffbed154-4ef7-542d-bbb7-c09d3a79fcae"
+version = "0.8.6"
+
+[[Downloads]]
+deps = ["ArgTools", "LibCURL", "NetworkOptions"]
+uuid = "f43a241f-c20a-4ad4-852c-f6b1247861c6"
+
+[[EarCut_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "3f3a2501fa7236e9b911e0f7a588c657e822bb6d"
+uuid = "5ae413db-bbd1-5e63-b57d-d24a61df00f5"
+version = "2.2.3+0"
+
+[[EllipsisNotation]]
+deps = ["ArrayInterface"]
+git-tree-sha1 = "d7ab55febfd0907b285fbf8dc0c73c0825d9d6aa"
+uuid = "da5c29d0-fa7d-589e-88eb-ea29b0a81949"
+version = "1.3.0"
+
+[[Expat_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "b3bfd02e98aedfa5cf885665493c5598c350cd2f"
+uuid = "2e619515-83b5-522b-bb60-26c02a35a201"
+version = "2.2.10+0"
+
+[[FFMPEG]]
+deps = ["FFMPEG_jll"]
+git-tree-sha1 = "b57e3acbe22f8484b4b5ff66a7499717fe1a9cc8"
+uuid = "c87230d0-a227-11e9-1b43-d7ebe4e7570a"
+version = "0.4.1"
+
+[[FFMPEG_jll]]
+deps = ["Artifacts", "Bzip2_jll", "FreeType2_jll", "FriBidi_jll", "JLLWrappers", "LAME_jll", "Libdl", "Ogg_jll", "OpenSSL_jll", "Opus_jll", "Pkg", "Zlib_jll", "libass_jll", "libfdk_aac_jll", "libvorbis_jll", "x264_jll", "x265_jll"]
+git-tree-sha1 = "d8a578692e3077ac998b50c0217dfd67f21d1e5f"
+uuid = "b22a6f82-2f65-5046-a5b2-351ab43fb4e5"
+version = "4.4.0+0"
+
+[[FFTW]]
+deps = ["AbstractFFTs", "FFTW_jll", "LinearAlgebra", "MKL_jll", "Preferences", "Reexport"]
+git-tree-sha1 = "463cb335fa22c4ebacfd1faba5fde14edb80d96c"
+uuid = "7a1cc6ca-52ef-59f5-83cd-3a7055c09341"
+version = "1.4.5"
+
+[[FFTW_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "c6033cc3892d0ef5bb9cd29b7f2f0331ea5184ea"
+uuid = "f5851436-0d7a-5f13-b9de-f02708fd171a"
+version = "3.3.10+0"
+
+[[FileIO]]
+deps = ["Pkg", "Requires", "UUIDs"]
+git-tree-sha1 = "67551df041955cc6ee2ed098718c8fcd7fc7aebe"
+uuid = "5789e2e9-d7fb-5bc7-8068-2c6fae9b9549"
+version = "1.12.0"
+
+[[FillArrays]]
+deps = ["LinearAlgebra", "Random", "SparseArrays", "Statistics"]
+git-tree-sha1 = "8756f9935b7ccc9064c6eef0bff0ad643df733a3"
+uuid = "1a297f60-69ca-5386-bcde-b61e274b549b"
+version = "0.12.7"
+
+[[FixedPointNumbers]]
+deps = ["Statistics"]
+git-tree-sha1 = "335bfdceacc84c5cdf16aadc768aa5ddfc5383cc"
+uuid = "53c48c17-4a7d-5ca2-90c5-79b7896eea93"
+version = "0.8.4"
+
+[[Fontconfig_jll]]
+deps = ["Artifacts", "Bzip2_jll", "Expat_jll", "FreeType2_jll", "JLLWrappers", "Libdl", "Libuuid_jll", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "21efd19106a55620a188615da6d3d06cd7f6ee03"
+uuid = "a3f928ae-7b40-5064-980b-68af3947d34b"
+version = "2.13.93+0"
+
+[[Formatting]]
+deps = ["Printf"]
+git-tree-sha1 = "8339d61043228fdd3eb658d86c926cb282ae72a8"
+uuid = "59287772-0a20-5a39-b81b-1366585eb4c0"
+version = "0.4.2"
+
+[[FreeType]]
+deps = ["CEnum", "FreeType2_jll"]
+git-tree-sha1 = "cabd77ab6a6fdff49bfd24af2ebe76e6e018a2b4"
+uuid = "b38be410-82b0-50bf-ab77-7b57e271db43"
+version = "4.0.0"
+
+[[FreeType2_jll]]
+deps = ["Artifacts", "Bzip2_jll", "JLLWrappers", "Libdl", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "87eb71354d8ec1a96d4a7636bd57a7347dde3ef9"
+uuid = "d7e528f0-a631-5988-bf34-fe36492bcfd7"
+version = "2.10.4+0"
+
+[[FreeTypeAbstraction]]
+deps = ["ColorVectorSpace", "Colors", "FreeType", "GeometryBasics", "StaticArrays"]
+git-tree-sha1 = "770050893e7bc8a34915b4b9298604a3236de834"
+uuid = "663a7486-cb36-511b-a19d-713bb74d65c9"
+version = "0.9.5"
+
+[[FriBidi_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "aa31987c2ba8704e23c6c8ba8a4f769d5d7e4f91"
+uuid = "559328eb-81f9-559d-9380-de523a88c83c"
+version = "1.0.10+0"
+
+[[GLFW_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Libglvnd_jll", "Pkg", "Xorg_libXcursor_jll", "Xorg_libXi_jll", "Xorg_libXinerama_jll", "Xorg_libXrandr_jll"]
+git-tree-sha1 = "0c603255764a1fa0b61752d2bec14cfbd18f7fe8"
+uuid = "0656b61e-2033-5cc2-a64a-77c0f6c09b89"
+version = "3.3.5+1"
+
+[[GR]]
+deps = ["Base64", "DelimitedFiles", "GR_jll", "HTTP", "JSON", "Libdl", "LinearAlgebra", "Pkg", "Printf", "Random", "RelocatableFolders", "Serialization", "Sockets", "Test", "UUIDs"]
+git-tree-sha1 = "4a740db447aae0fbeb3ee730de1afbb14ac798a1"
+uuid = "28b8d3ca-fb5f-59d9-8090-bfdbd6d07a71"
+version = "0.63.1"
+
+[[GR_jll]]
+deps = ["Artifacts", "Bzip2_jll", "Cairo_jll", "FFMPEG_jll", "Fontconfig_jll", "GLFW_jll", "JLLWrappers", "JpegTurbo_jll", "Libdl", "Libtiff_jll", "Pixman_jll", "Pkg", "Qt5Base_jll", "Zlib_jll", "libpng_jll"]
+git-tree-sha1 = "aa22e1ee9e722f1da183eb33370df4c1aeb6c2cd"
+uuid = "d2c73de3-f751-5644-a686-071e5b155ba9"
+version = "0.63.1+0"
+
+[[GeometryBasics]]
+deps = ["EarCut_jll", "IterTools", "LinearAlgebra", "StaticArrays", "StructArrays", "Tables"]
+git-tree-sha1 = "58bcdf5ebc057b085e58d95c138725628dd7453c"
+uuid = "5c1252a2-5f33-56bf-86c9-59e7332b4326"
+version = "0.4.1"
+
+[[Gettext_jll]]
+deps = ["Artifacts", "CompilerSupportLibraries_jll", "JLLWrappers", "Libdl", "Libiconv_jll", "Pkg", "XML2_jll"]
+git-tree-sha1 = "9b02998aba7bf074d14de89f9d37ca24a1a0b046"
+uuid = "78b55507-aeef-58d4-861c-77aaff3498b1"
+version = "0.21.0+0"
+
+[[Glib_jll]]
+deps = ["Artifacts", "Gettext_jll", "JLLWrappers", "Libdl", "Libffi_jll", "Libiconv_jll", "Libmount_jll", "PCRE_jll", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "a32d672ac2c967f3deb8a81d828afc739c838a06"
+uuid = "7746bdde-850d-59dc-9ae8-88ece973131d"
+version = "2.68.3+2"
+
+[[GraphMakie]]
+deps = ["GeometryBasics", "Graphs", "LinearAlgebra", "Makie", "NetworkLayout", "StaticArrays"]
+git-tree-sha1 = "8fc75ea16d1836cbcfb94227605afd49d5f3facf"
+uuid = "1ecd5474-83a3-4783-bb4f-06765db800d2"
+version = "0.3.1"
+
+[[Graphics]]
+deps = ["Colors", "LinearAlgebra", "NaNMath"]
+git-tree-sha1 = "1c5a84319923bea76fa145d49e93aa4394c73fc2"
+uuid = "a2bd30eb-e257-5431-a919-1863eab51364"
+version = "1.1.1"
+
+[[Graphite2_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "344bf40dcab1073aca04aa0df4fb092f920e4011"
+uuid = "3b182d85-2403-5c21-9c21-1e1f0cc25472"
+version = "1.3.14+0"
+
+[[Graphs]]
+deps = ["ArnoldiMethod", "Compat", "DataStructures", "Distributed", "Inflate", "LinearAlgebra", "Random", "SharedArrays", "SimpleTraits", "SparseArrays", "Statistics"]
+git-tree-sha1 = "d727758173afef0af878b29ac364a0eca299fc6b"
+uuid = "86223c79-3864-5bf0-83f7-82e725a168b6"
+version = "1.5.1"
+
+[[GridLayoutBase]]
+deps = ["GeometryBasics", "InteractiveUtils", "Observables"]
+git-tree-sha1 = "70938436e2720e6cb8a7f2ca9f1bbdbf40d7f5d0"
+uuid = "3955a311-db13-416c-9275-1d80ed98e5e9"
+version = "0.6.4"
+
+[[Grisu]]
+git-tree-sha1 = "53bb909d1151e57e2484c3d1b53e19552b887fb2"
+uuid = "42e2da0e-8278-4e71-bc24-59509adca0fe"
+version = "1.0.2"
+
+[[HTTP]]
+deps = ["Base64", "Dates", "IniFile", "Logging", "MbedTLS", "NetworkOptions", "Sockets", "URIs"]
+git-tree-sha1 = "0fa77022fe4b511826b39c894c90daf5fce3334a"
+uuid = "cd3eb016-35fb-5094-929b-558a96fad6f3"
+version = "0.9.17"
+
+[[HarfBuzz_jll]]
+deps = ["Artifacts", "Cairo_jll", "Fontconfig_jll", "FreeType2_jll", "Glib_jll", "Graphite2_jll", "JLLWrappers", "Libdl", "Libffi_jll", "Pkg"]
+git-tree-sha1 = "129acf094d168394e80ee1dc4bc06ec835e510a3"
+uuid = "2e76f6c2-a576-52d4-95c1-20adfe4de566"
+version = "2.8.1+1"
+
+[[Hyperscript]]
+deps = ["Test"]
+git-tree-sha1 = "8d511d5b81240fc8e6802386302675bdf47737b9"
+uuid = "47d2ed2b-36de-50cf-bf87-49c2cf4b8b91"
+version = "0.0.4"
+
+[[HypertextLiteral]]
+git-tree-sha1 = "2b078b5a615c6c0396c77810d92ee8c6f470d238"
+uuid = "ac1192a8-f4b3-4bfe-ba22-af5b92cd3ab2"
+version = "0.9.3"
+
+[[IOCapture]]
+deps = ["Logging", "Random"]
+git-tree-sha1 = "f7be53659ab06ddc986428d3a9dcc95f6fa6705a"
+uuid = "b5f81e59-6552-4d32-b1f0-c071b021bf89"
+version = "0.2.2"
+
+[[IfElse]]
+git-tree-sha1 = "debdd00ffef04665ccbb3e150747a77560e8fad1"
+uuid = "615f187c-cbe4-4ef1-ba3b-2fcf58d6d173"
+version = "0.1.1"
+
+[[ImageCore]]
+deps = ["AbstractFFTs", "ColorVectorSpace", "Colors", "FixedPointNumbers", "Graphics", "MappedArrays", "MosaicViews", "OffsetArrays", "PaddedViews", "Reexport"]
+git-tree-sha1 = "9a5c62f231e5bba35695a20988fc7cd6de7eeb5a"
+uuid = "a09fc81d-aa75-5fe9-8630-4744c3626534"
+version = "0.9.3"
+
+[[ImageIO]]
+deps = ["FileIO", "Netpbm", "OpenEXR", "PNGFiles", "TiffImages", "UUIDs"]
+git-tree-sha1 = "a2951c93684551467265e0e32b577914f69532be"
+uuid = "82e4d734-157c-48bb-816b-45c225c6df19"
+version = "0.5.9"
+
+[[Imath_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "87f7662e03a649cffa2e05bf19c303e168732d3e"
+uuid = "905a6f67-0a94-5f89-b386-d35d92009cd1"
+version = "3.1.2+0"
+
+[[IndirectArrays]]
+git-tree-sha1 = "012e604e1c7458645cb8b436f8fba789a51b257f"
+uuid = "9b13fd28-a010-5f03-acff-a1bbcff69959"
+version = "1.0.0"
+
+[[Inflate]]
+git-tree-sha1 = "f5fc07d4e706b84f72d54eedcc1c13d92fb0871c"
+uuid = "d25df0c9-e2be-5dd7-82c8-3ad0b3e990b9"
+version = "0.1.2"
+
+[[IniFile]]
+deps = ["Test"]
+git-tree-sha1 = "098e4d2c533924c921f9f9847274f2ad89e018b8"
+uuid = "83e8ac13-25f8-5344-8a64-a9f2b223428f"
+version = "0.5.0"
+
+[[IntelOpenMP_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "d979e54b71da82f3a65b62553da4fc3d18c9004c"
+uuid = "1d5cc7b8-4909-519e-a0f8-d0f5ad9712d0"
+version = "2018.0.3+2"
+
+[[InteractiveUtils]]
+deps = ["Markdown"]
+uuid = "b77e0a4c-d291-57a0-90e8-8db25a27a240"
+
+[[Interpolations]]
+deps = ["AxisAlgorithms", "ChainRulesCore", "LinearAlgebra", "OffsetArrays", "Random", "Ratios", "Requires", "SharedArrays", "SparseArrays", "StaticArrays", "WoodburyMatrices"]
+git-tree-sha1 = "b15fc0a95c564ca2e0a7ae12c1f095ca848ceb31"
+uuid = "a98d9a8b-a2ab-59e6-89dd-64a1c18fca59"
+version = "0.13.5"
+
+[[IntervalSets]]
+deps = ["Dates", "EllipsisNotation", "Statistics"]
+git-tree-sha1 = "3cc368af3f110a767ac786560045dceddfc16758"
+uuid = "8197267c-284f-5f27-9208-e0e47529a953"
+version = "0.5.3"
+
+[[InverseFunctions]]
+deps = ["Test"]
+git-tree-sha1 = "a7254c0acd8e62f1ac75ad24d5db43f5f19f3c65"
+uuid = "3587e190-3f89-42d0-90ee-14403ec27112"
+version = "0.1.2"
+
+[[IrrationalConstants]]
+git-tree-sha1 = "7fd44fd4ff43fc60815f8e764c0f352b83c49151"
+uuid = "92d709cd-6900-40b7-9082-c6be49f344b6"
+version = "0.1.1"
+
+[[Isoband]]
+deps = ["isoband_jll"]
+git-tree-sha1 = "f9b6d97355599074dc867318950adaa6f9946137"
+uuid = "f1662d9f-8043-43de-a69a-05efc1cc6ff4"
+version = "0.1.1"
+
+[[IterTools]]
+git-tree-sha1 = "fa6287a4469f5e048d763df38279ee729fbd44e5"
+uuid = "c8e1da08-722c-5040-9ed9-7db0dc04731e"
+version = "1.4.0"
+
+[[IteratorInterfaceExtensions]]
+git-tree-sha1 = "a3f24677c21f5bbe9d2a714f95dcd58337fb2856"
+uuid = "82899510-4779-5014-852e-03e436cf321d"
+version = "1.0.0"
+
+[[JLLWrappers]]
+deps = ["Preferences"]
+git-tree-sha1 = "22df5b96feef82434b07327e2d3c770a9b21e023"
+uuid = "692b3bcd-3c85-4b1f-b108-f13ce0eb3210"
+version = "1.4.0"
+
+[[JSON]]
+deps = ["Dates", "Mmap", "Parsers", "Unicode"]
+git-tree-sha1 = "8076680b162ada2a031f707ac7b4953e30667a37"
+uuid = "682c06a0-de6a-54ab-a142-c8b1cf79cde6"
+version = "0.21.2"
+
+[[JpegTurbo_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "d735490ac75c5cb9f1b00d8b5509c11984dc6943"
+uuid = "aacddb02-875f-59d6-b918-886e6ef4fbf8"
+version = "2.1.0+0"
+
+[[KernelDensity]]
+deps = ["Distributions", "DocStringExtensions", "FFTW", "Interpolations", "StatsBase"]
+git-tree-sha1 = "591e8dc09ad18386189610acafb970032c519707"
+uuid = "5ab0869b-81aa-558d-bb23-cbf5423bbe9b"
+version = "0.6.3"
+
+[[LAME_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "f6250b16881adf048549549fba48b1161acdac8c"
+uuid = "c1c5ebd0-6772-5130-a774-d5fcae4a789d"
+version = "3.100.1+0"
+
+[[LZO_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "e5b909bcf985c5e2605737d2ce278ed791b89be6"
+uuid = "dd4b983a-f0e5-5f8d-a1b7-129d4a5fb1ac"
+version = "2.10.1+0"
+
+[[LaTeXStrings]]
+git-tree-sha1 = "f2355693d6778a178ade15952b7ac47a4ff97996"
+uuid = "b964fa9f-0449-5b57-a5c2-d3ea65f4040f"
+version = "1.3.0"
+
+[[Latexify]]
+deps = ["Formatting", "InteractiveUtils", "LaTeXStrings", "MacroTools", "Markdown", "Printf", "Requires"]
+git-tree-sha1 = "a8f4f279b6fa3c3c4f1adadd78a621b13a506bce"
+uuid = "23fbe1c1-3f47-55db-b15f-69d7ec21a316"
+version = "0.15.9"
+
+[[LazyArtifacts]]
+deps = ["Artifacts", "Pkg"]
+uuid = "4af54fe1-eca0-43a8-85a7-787d91b784e3"
+
+[[LibCURL]]
+deps = ["LibCURL_jll", "MozillaCACerts_jll"]
+uuid = "b27032c2-a3e7-50c8-80cd-2d36dbcbfd21"
+
+[[LibCURL_jll]]
+deps = ["Artifacts", "LibSSH2_jll", "Libdl", "MbedTLS_jll", "Zlib_jll", "nghttp2_jll"]
+uuid = "deac9b47-8bc7-5906-a0fe-35ac56dc84c0"
+
+[[LibGit2]]
+deps = ["Base64", "NetworkOptions", "Printf", "SHA"]
+uuid = "76f85450-5226-5b5a-8eaa-529ad045b433"
+
+[[LibSSH2_jll]]
+deps = ["Artifacts", "Libdl", "MbedTLS_jll"]
+uuid = "29816b5a-b9ab-546f-933c-edad1886dfa8"
+
+[[Libdl]]
+uuid = "8f399da3-3557-5675-b5ff-fb832c97cbdb"
+
+[[Libffi_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "0b4a5d71f3e5200a7dff793393e09dfc2d874290"
+uuid = "e9f186c6-92d2-5b65-8a66-fee21dc1b490"
+version = "3.2.2+1"
+
+[[Libgcrypt_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Libgpg_error_jll", "Pkg"]
+git-tree-sha1 = "64613c82a59c120435c067c2b809fc61cf5166ae"
+uuid = "d4300ac3-e22c-5743-9152-c294e39db1e4"
+version = "1.8.7+0"
+
+[[Libglvnd_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libX11_jll", "Xorg_libXext_jll"]
+git-tree-sha1 = "7739f837d6447403596a75d19ed01fd08d6f56bf"
+uuid = "7e76a0d4-f3c7-5321-8279-8d96eeed0f29"
+version = "1.3.0+3"
+
+[[Libgpg_error_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "c333716e46366857753e273ce6a69ee0945a6db9"
+uuid = "7add5ba3-2f88-524e-9cd5-f83b8a55f7b8"
+version = "1.42.0+0"
+
+[[Libiconv_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "42b62845d70a619f063a7da093d995ec8e15e778"
+uuid = "94ce4f54-9a6c-5748-9c1c-f9c7231a4531"
+version = "1.16.1+1"
+
+[[Libmount_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "9c30530bf0effd46e15e0fdcf2b8636e78cbbd73"
+uuid = "4b2f31a3-9ecc-558c-b454-b3730dcb73e9"
+version = "2.35.0+0"
+
+[[Libtiff_jll]]
+deps = ["Artifacts", "JLLWrappers", "JpegTurbo_jll", "Libdl", "Pkg", "Zlib_jll", "Zstd_jll"]
+git-tree-sha1 = "340e257aada13f95f98ee352d316c3bed37c8ab9"
+uuid = "89763e89-9b03-5906-acba-b20f662cd828"
+version = "4.3.0+0"
+
+[[Libuuid_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "7f3efec06033682db852f8b3bc3c1d2b0a0ab066"
+uuid = "38a345b3-de98-5d2b-a5d3-14cd9215e700"
+version = "2.36.0+0"
+
+[[LinearAlgebra]]
+deps = ["Libdl"]
+uuid = "37e2e46d-f89d-539d-b4ee-838fcccc9c8e"
+
+[[LogExpFunctions]]
+deps = ["ChainRulesCore", "ChangesOfVariables", "DocStringExtensions", "InverseFunctions", "IrrationalConstants", "LinearAlgebra"]
+git-tree-sha1 = "e5718a00af0ab9756305a0392832c8952c7426c1"
+uuid = "2ab3a3ac-af41-5b50-aa03-7779005ae688"
+version = "0.3.6"
+
+[[Logging]]
+uuid = "56ddb016-857b-54e1-b83d-db4d58db5568"
+
+[[MKL_jll]]
+deps = ["Artifacts", "IntelOpenMP_jll", "JLLWrappers", "LazyArtifacts", "Libdl", "Pkg"]
+git-tree-sha1 = "5455aef09b40e5020e1520f551fa3135040d4ed0"
+uuid = "856f044c-d86e-5d09-b602-aeab76dc8ba7"
+version = "2021.1.1+2"
+
+[[MacroTools]]
+deps = ["Markdown", "Random"]
+git-tree-sha1 = "3d3e902b31198a27340d0bf00d6ac452866021cf"
+uuid = "1914dd2f-81c6-5fcd-8719-6d5c9610ff09"
+version = "0.5.9"
+
+[[Makie]]
+deps = ["Animations", "Base64", "ColorBrewer", "ColorSchemes", "ColorTypes", "Colors", "Contour", "Distributions", "DocStringExtensions", "FFMPEG", "FileIO", "FixedPointNumbers", "Formatting", "FreeType", "FreeTypeAbstraction", "GeometryBasics", "GridLayoutBase", "ImageIO", "IntervalSets", "Isoband", "KernelDensity", "LaTeXStrings", "LinearAlgebra", "MakieCore", "Markdown", "Match", "MathTeXEngine", "Observables", "Packing", "PlotUtils", "PolygonOps", "Printf", "Random", "RelocatableFolders", "Serialization", "Showoff", "SignedDistanceFields", "SparseArrays", "StaticArrays", "Statistics", "StatsBase", "StatsFuns", "StructArrays", "UnicodeFun"]
+git-tree-sha1 = "56b0b7772676c499430dc8eb15cfab120c05a150"
+uuid = "ee78f7c6-11fb-53f2-987a-cfe4a2b5a57a"
+version = "0.15.3"
+
+[[MakieCore]]
+deps = ["Observables"]
+git-tree-sha1 = "7bcc8323fb37523a6a51ade2234eee27a11114c8"
+uuid = "20f20a25-4f0e-4fdf-b5d1-57303727442b"
+version = "0.1.3"
+
+[[MappedArrays]]
+git-tree-sha1 = "e8b359ef06ec72e8c030463fe02efe5527ee5142"
+uuid = "dbb5928d-eab1-5f90-85c2-b9b0edb7c900"
+version = "0.4.1"
+
+[[Markdown]]
+deps = ["Base64"]
+uuid = "d6f4376e-aef5-505a-96c1-9c027394607a"
+
+[[Match]]
+git-tree-sha1 = "1d9bc5c1a6e7ee24effb93f175c9342f9154d97f"
+uuid = "7eb4fadd-790c-5f42-8a69-bfa0b872bfbf"
+version = "1.2.0"
+
+[[MathTeXEngine]]
+deps = ["AbstractTrees", "Automa", "DataStructures", "FreeTypeAbstraction", "GeometryBasics", "LaTeXStrings", "REPL", "RelocatableFolders", "Test"]
+git-tree-sha1 = "70e733037bbf02d691e78f95171a1fa08cdc6332"
+uuid = "0a4f8689-d25c-4efe-a92b-7142dfc1aa53"
+version = "0.2.1"
+
+[[MbedTLS]]
+deps = ["Dates", "MbedTLS_jll", "Random", "Sockets"]
+git-tree-sha1 = "1c38e51c3d08ef2278062ebceade0e46cefc96fe"
+uuid = "739be429-bea8-5141-9913-cc70e7f3736d"
+version = "1.0.3"
+
+[[MbedTLS_jll]]
+deps = ["Artifacts", "Libdl"]
+uuid = "c8ffd9c3-330d-5841-b78e-0817d7145fa1"
+
+[[Measures]]
+git-tree-sha1 = "e498ddeee6f9fdb4551ce855a46f54dbd900245f"
+uuid = "442fdcdd-2543-5da2-b0f3-8c86c306513e"
+version = "0.3.1"
+
+[[Missings]]
+deps = ["DataAPI"]
+git-tree-sha1 = "bf210ce90b6c9eed32d25dbcae1ebc565df2687f"
+uuid = "e1d29d7a-bbdc-5cf2-9ac0-f12de2c33e28"
+version = "1.0.2"
+
+[[Mmap]]
+uuid = "a63ad114-7e13-5084-954f-fe012c677804"
+
+[[MosaicViews]]
+deps = ["MappedArrays", "OffsetArrays", "PaddedViews", "StackViews"]
+git-tree-sha1 = "b34e3bc3ca7c94914418637cb10cc4d1d80d877d"
+uuid = "e94cdb99-869f-56ef-bcf0-1ae2bcbe0389"
+version = "0.3.3"
+
+[[MozillaCACerts_jll]]
+uuid = "14a3606d-f60d-562e-9121-12d972cd8159"
+
+[[NaNMath]]
+git-tree-sha1 = "f755f36b19a5116bb580de457cda0c140153f283"
+uuid = "77ba4419-2d1f-58cd-9bb1-8ffee604a2e3"
+version = "0.3.6"
+
+[[Netpbm]]
+deps = ["FileIO", "ImageCore"]
+git-tree-sha1 = "18efc06f6ec36a8b801b23f076e3c6ac7c3bf153"
+uuid = "f09324ee-3d7c-5217-9330-fc30815ba969"
+version = "1.0.2"
+
+[[NetworkLayout]]
+deps = ["GeometryBasics", "LinearAlgebra", "Random", "Requires", "SparseArrays"]
+git-tree-sha1 = "cac8fc7ba64b699c678094fa630f49b80618f625"
+uuid = "46757867-2c16-5918-afeb-47bfcb05e46a"
+version = "0.4.4"
+
+[[NetworkOptions]]
+uuid = "ca575930-c2e3-43a9-ace4-1e988b2c1908"
+
+[[Observables]]
+git-tree-sha1 = "fe29afdef3d0c4a8286128d4e45cc50621b1e43d"
+uuid = "510215fc-4207-5dde-b226-833fc4488ee2"
+version = "0.4.0"
+
+[[OffsetArrays]]
+deps = ["Adapt"]
+git-tree-sha1 = "043017e0bdeff61cfbb7afeb558ab29536bbb5ed"
+uuid = "6fe1bfb0-de20-5000-8ca7-80f57d26f881"
+version = "1.10.8"
+
+[[Ogg_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "887579a3eb005446d514ab7aeac5d1d027658b8f"
+uuid = "e7412a2a-1a6e-54c0-be00-318e2571c051"
+version = "1.3.5+1"
+
+[[OpenEXR]]
+deps = ["Colors", "FileIO", "OpenEXR_jll"]
+git-tree-sha1 = "327f53360fdb54df7ecd01e96ef1983536d1e633"
+uuid = "52e1d378-f018-4a11-a4be-720524705ac7"
+version = "0.3.2"
+
+[[OpenEXR_jll]]
+deps = ["Artifacts", "Imath_jll", "JLLWrappers", "Libdl", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "923319661e9a22712f24596ce81c54fc0366f304"
+uuid = "18a262bb-aa17-5467-a713-aee519bc75cb"
+version = "3.1.1+0"
+
+[[OpenLibm_jll]]
+deps = ["Artifacts", "Libdl"]
+uuid = "05823500-19ac-5b8b-9628-191a04bc5112"
+
+[[OpenSSL_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "648107615c15d4e09f7eca16307bc821c1f718d8"
+uuid = "458c3c95-2e84-50aa-8efc-19380b2a3a95"
+version = "1.1.13+0"
+
+[[OpenSpecFun_jll]]
+deps = ["Artifacts", "CompilerSupportLibraries_jll", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "13652491f6856acfd2db29360e1bbcd4565d04f1"
+uuid = "efe28fd5-8261-553b-a9e1-b2916fc3738e"
+version = "0.5.5+0"
+
+[[Opus_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "51a08fb14ec28da2ec7a927c4337e4332c2a4720"
+uuid = "91d4177d-7536-5919-b921-800302f37372"
+version = "1.3.2+0"
+
+[[OrderedCollections]]
+git-tree-sha1 = "85f8e6578bf1f9ee0d11e7bb1b1456435479d47c"
+uuid = "bac558e1-5e72-5ebc-8fee-abe8a469f55d"
+version = "1.4.1"
+
+[[PCRE_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "b2a7af664e098055a7529ad1a900ded962bca488"
+uuid = "2f80f16e-611a-54ab-bc61-aa92de5b98fc"
+version = "8.44.0+0"
+
+[[PDMats]]
+deps = ["LinearAlgebra", "SparseArrays", "SuiteSparse"]
+git-tree-sha1 = "ee26b350276c51697c9c2d88a072b339f9f03d73"
+uuid = "90014a1f-27ba-587c-ab20-58faa44d9150"
+version = "0.11.5"
+
+[[PNGFiles]]
+deps = ["Base64", "CEnum", "ImageCore", "IndirectArrays", "OffsetArrays", "libpng_jll"]
+git-tree-sha1 = "6d105d40e30b635cfed9d52ec29cf456e27d38f8"
+uuid = "f57f5aa1-a3ce-4bc8-8ab9-96f992907883"
+version = "0.3.12"
+
+[[Packing]]
+deps = ["GeometryBasics"]
+git-tree-sha1 = "1155f6f937fa2b94104162f01fa400e192e4272f"
+uuid = "19eb6ba3-879d-56ad-ad62-d5c202156566"
+version = "0.4.2"
+
+[[PaddedViews]]
+deps = ["OffsetArrays"]
+git-tree-sha1 = "03a7a85b76381a3d04c7a1656039197e70eda03d"
+uuid = "5432bcbf-9aad-5242-b902-cca2824c8663"
+version = "0.5.11"
+
+[[Pango_jll]]
+deps = ["Artifacts", "Cairo_jll", "Fontconfig_jll", "FreeType2_jll", "FriBidi_jll", "Glib_jll", "HarfBuzz_jll", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "9bc1871464b12ed19297fbc56c4fb4ba84988b0d"
+uuid = "36c8627f-9965-5494-a995-c6b170f724f3"
+version = "1.47.0+0"
+
+[[Parsers]]
+deps = ["Dates"]
+git-tree-sha1 = "92f91ba9e5941fc781fecf5494ac1da87bdac775"
+uuid = "69de0a69-1ddd-5017-9359-2bf0b02dc9f0"
+version = "2.2.0"
+
+[[Pixman_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "b4f5d02549a10e20780a24fce72bea96b6329e29"
+uuid = "30392449-352a-5448-841d-b1acce4e97dc"
+version = "0.40.1+0"
+
+[[Pkg]]
+deps = ["Artifacts", "Dates", "Downloads", "LibGit2", "Libdl", "Logging", "Markdown", "Printf", "REPL", "Random", "SHA", "Serialization", "TOML", "Tar", "UUIDs", "p7zip_jll"]
+uuid = "44cfe95a-1eb2-52ea-b672-e2afdf69b78f"
+
+[[PkgVersion]]
+deps = ["Pkg"]
+git-tree-sha1 = "a7a7e1a88853564e551e4eba8650f8c38df79b37"
+uuid = "eebad327-c553-4316-9ea0-9fa01ccd7688"
+version = "0.1.1"
+
+[[PlotThemes]]
+deps = ["PlotUtils", "Requires", "Statistics"]
+git-tree-sha1 = "a3a964ce9dc7898193536002a6dd892b1b5a6f1d"
+uuid = "ccf2f8ad-2431-5c83-bf29-c5338b663b6a"
+version = "2.0.1"
+
+[[PlotUtils]]
+deps = ["ColorSchemes", "Colors", "Dates", "Printf", "Random", "Reexport", "Statistics"]
+git-tree-sha1 = "6f1b25e8ea06279b5689263cc538f51331d7ca17"
+uuid = "995b91a9-d308-5afd-9ec6-746e21dbc043"
+version = "1.1.3"
+
+[[Plots]]
+deps = ["Base64", "Contour", "Dates", "Downloads", "FFMPEG", "FixedPointNumbers", "GR", "GeometryBasics", "JSON", "Latexify", "LinearAlgebra", "Measures", "NaNMath", "PlotThemes", "PlotUtils", "Printf", "REPL", "Random", "RecipesBase", "RecipesPipeline", "Reexport", "Requires", "Scratch", "Showoff", "SparseArrays", "Statistics", "StatsBase", "UUIDs", "UnicodeFun", "Unzip"]
+git-tree-sha1 = "db7393a80d0e5bef70f2b518990835541917a544"
+uuid = "91a5bcdd-55d7-5caf-9e0b-520d859cae80"
+version = "1.25.6"
+
+[[PlutoUI]]
+deps = ["AbstractPlutoDingetjes", "Base64", "Dates", "Hyperscript", "HypertextLiteral", "IOCapture", "InteractiveUtils", "JSON", "Logging", "Markdown", "Random", "Reexport", "UUIDs"]
+git-tree-sha1 = "5152abbdab6488d5eec6a01029ca6697dff4ec8f"
+uuid = "7f904dfe-b85e-4ff6-b463-dae2292396a8"
+version = "0.7.23"
+
+[[PolygonOps]]
+git-tree-sha1 = "77b3d3605fc1cd0b42d95eba87dfcd2bf67d5ff6"
+uuid = "647866c9-e3ac-4575-94e7-e3d426903924"
+version = "0.1.2"
+
+[[Preferences]]
+deps = ["TOML"]
+git-tree-sha1 = "2cf929d64681236a2e074ffafb8d568733d2e6af"
+uuid = "21216c6a-2e73-6563-6e65-726566657250"
+version = "1.2.3"
+
+[[Printf]]
+deps = ["Unicode"]
+uuid = "de0858da-6303-5e67-8744-51eddeeeb8d7"
+
+[[ProgressMeter]]
+deps = ["Distributed", "Printf"]
+git-tree-sha1 = "afadeba63d90ff223a6a48d2009434ecee2ec9e8"
+uuid = "92933f4c-e287-5a05-a399-4b506db050ca"
+version = "1.7.1"
+
+[[Qt5Base_jll]]
+deps = ["Artifacts", "CompilerSupportLibraries_jll", "Fontconfig_jll", "Glib_jll", "JLLWrappers", "Libdl", "Libglvnd_jll", "OpenSSL_jll", "Pkg", "Xorg_libXext_jll", "Xorg_libxcb_jll", "Xorg_xcb_util_image_jll", "Xorg_xcb_util_keysyms_jll", "Xorg_xcb_util_renderutil_jll", "Xorg_xcb_util_wm_jll", "Zlib_jll", "xkbcommon_jll"]
+git-tree-sha1 = "ad368663a5e20dbb8d6dc2fddeefe4dae0781ae8"
+uuid = "ea2cea3b-5b76-57ae-a6ef-0a8af62496e1"
+version = "5.15.3+0"
+
+[[QuadGK]]
+deps = ["DataStructures", "LinearAlgebra"]
+git-tree-sha1 = "78aadffb3efd2155af139781b8a8df1ef279ea39"
+uuid = "1fd47b50-473d-5c70-9696-f719f8f3bcdc"
+version = "2.4.2"
+
+[[REPL]]
+deps = ["InteractiveUtils", "Markdown", "Sockets", "Unicode"]
+uuid = "3fa0cd96-eef1-5676-8a61-b3b8758bbffb"
+
+[[Random]]
+deps = ["Serialization"]
+uuid = "9a3f8284-a2c9-5f02-9a11-845980a1fd5c"
+
+[[Ratios]]
+deps = ["Requires"]
+git-tree-sha1 = "01d341f502250e81f6fec0afe662aa861392a3aa"
+uuid = "c84ed2f1-dad5-54f0-aa8e-dbefe2724439"
+version = "0.4.2"
+
+[[RecipesBase]]
+git-tree-sha1 = "6bf3f380ff52ce0832ddd3a2a7b9538ed1bcca7d"
+uuid = "3cdcf5f2-1ef4-517c-9805-6587b60abb01"
+version = "1.2.1"
+
+[[RecipesPipeline]]
+deps = ["Dates", "NaNMath", "PlotUtils", "RecipesBase"]
+git-tree-sha1 = "37c1631cb3cc36a535105e6d5557864c82cd8c2b"
+uuid = "01d81517-befc-4cb6-b9ec-a95719d0359c"
+version = "0.5.0"
+
+[[Reexport]]
+git-tree-sha1 = "45e428421666073eab6f2da5c9d310d99bb12f9b"
+uuid = "189a3867-3050-52da-a836-e630ba90ab69"
+version = "1.2.2"
+
+[[RelocatableFolders]]
+deps = ["SHA", "Scratch"]
+git-tree-sha1 = "cdbd3b1338c72ce29d9584fdbe9e9b70eeb5adca"
+uuid = "05181044-ff0b-4ac5-8273-598c1e38db00"
+version = "0.1.3"
+
+[[Requires]]
+deps = ["UUIDs"]
+git-tree-sha1 = "838a3a4188e2ded87a4f9f184b4b0d78a1e91cb7"
+uuid = "ae029012-a4dd-5104-9daa-d747884805df"
+version = "1.3.0"
+
+[[Rmath]]
+deps = ["Random", "Rmath_jll"]
+git-tree-sha1 = "bf3188feca147ce108c76ad82c2792c57abe7b1f"
+uuid = "79098fc4-a85e-5d69-aa6a-4863f24498fa"
+version = "0.7.0"
+
+[[Rmath_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "68db32dff12bb6127bac73c209881191bf0efbb7"
+uuid = "f50d1b31-88e8-58de-be2c-1cc44531875f"
+version = "0.3.0+0"
+
+[[SHA]]
+uuid = "ea8e919c-243c-51af-8825-aaa63cd721ce"
+
+[[SIMD]]
+git-tree-sha1 = "39e3df417a0dd0c4e1f89891a281f82f5373ea3b"
+uuid = "fdea26ae-647d-5447-a871-4b548cad5224"
+version = "3.4.0"
+
+[[ScanByte]]
+deps = ["Libdl", "SIMD"]
+git-tree-sha1 = "9cc2955f2a254b18be655a4ee70bc4031b2b189e"
+uuid = "7b38b023-a4d7-4c5e-8d43-3f3097f304eb"
+version = "0.3.0"
+
+[[Scratch]]
+deps = ["Dates"]
+git-tree-sha1 = "0b4b7f1393cff97c33891da2a0bf69c6ed241fda"
+uuid = "6c6a2e73-6563-6170-7368-637461726353"
+version = "1.1.0"
+
+[[Serialization]]
+uuid = "9e88b42a-f829-5b0c-bbe9-9e923198166b"
+
+[[SharedArrays]]
+deps = ["Distributed", "Mmap", "Random", "Serialization"]
+uuid = "1a1011a3-84de-559e-8e89-a11a2f7dc383"
+
+[[Showoff]]
+deps = ["Dates", "Grisu"]
+git-tree-sha1 = "91eddf657aca81df9ae6ceb20b959ae5653ad1de"
+uuid = "992d4aef-0814-514b-bc4d-f2e9a6c4116f"
+version = "1.0.3"
+
+[[SignedDistanceFields]]
+deps = ["Random", "Statistics", "Test"]
+git-tree-sha1 = "d263a08ec505853a5ff1c1ebde2070419e3f28e9"
+uuid = "73760f76-fbc4-59ce-8f25-708e95d2df96"
+version = "0.4.0"
+
+[[SimpleTraits]]
+deps = ["InteractiveUtils", "MacroTools"]
+git-tree-sha1 = "5d7e3f4e11935503d3ecaf7186eac40602e7d231"
+uuid = "699a6c99-e7fa-54fc-8d76-47d257e15c1d"
+version = "0.9.4"
+
+[[Sockets]]
+uuid = "6462fe0b-24de-5631-8697-dd941f90decc"
+
+[[SortingAlgorithms]]
+deps = ["DataStructures"]
+git-tree-sha1 = "b3363d7460f7d098ca0912c69b082f75625d7508"
+uuid = "a2af1166-a08f-5f64-846c-94a0d3cef48c"
+version = "1.0.1"
+
+[[SparseArrays]]
+deps = ["LinearAlgebra", "Random"]
+uuid = "2f01184e-e22b-5df5-ae63-d93ebab69eaf"
+
+[[SpecialFunctions]]
+deps = ["ChainRulesCore", "IrrationalConstants", "LogExpFunctions", "OpenLibm_jll", "OpenSpecFun_jll"]
+git-tree-sha1 = "e08890d19787ec25029113e88c34ec20cac1c91e"
+uuid = "276daf66-3868-5448-9aa4-cd146d93841b"
+version = "2.0.0"
+
+[[StackViews]]
+deps = ["OffsetArrays"]
+git-tree-sha1 = "46e589465204cd0c08b4bd97385e4fa79a0c770c"
+uuid = "cae243ae-269e-4f55-b966-ac2d0dc13c15"
+version = "0.1.1"
+
+[[Static]]
+deps = ["IfElse"]
+git-tree-sha1 = "b4912cd034cdf968e06ca5f943bb54b17b97793a"
+uuid = "aedffcd0-7271-4cad-89d0-dc628f76c6d3"
+version = "0.5.1"
+
+[[StaticArrays]]
+deps = ["LinearAlgebra", "Random", "Statistics"]
+git-tree-sha1 = "2884859916598f974858ff01df7dfc6c708dd895"
+uuid = "90137ffa-7385-5640-81b9-e52037218182"
+version = "1.3.3"
+
+[[Statistics]]
+deps = ["LinearAlgebra", "SparseArrays"]
+uuid = "10745b16-79ce-11e8-11f9-7d13ad32a3b2"
+
+[[StatsAPI]]
+git-tree-sha1 = "d88665adc9bcf45903013af0982e2fd05ae3d0a6"
+uuid = "82ae8749-77ed-4fe6-ae5f-f523153014b0"
+version = "1.2.0"
+
+[[StatsBase]]
+deps = ["DataAPI", "DataStructures", "LinearAlgebra", "LogExpFunctions", "Missings", "Printf", "Random", "SortingAlgorithms", "SparseArrays", "Statistics", "StatsAPI"]
+git-tree-sha1 = "51383f2d367eb3b444c961d485c565e4c0cf4ba0"
+uuid = "2913bbd2-ae8a-5f71-8c99-4fb6c76f3a91"
+version = "0.33.14"
+
+[[StatsFuns]]
+deps = ["ChainRulesCore", "InverseFunctions", "IrrationalConstants", "LogExpFunctions", "Reexport", "Rmath", "SpecialFunctions"]
+git-tree-sha1 = "f35e1879a71cca95f4826a14cdbf0b9e253ed918"
+uuid = "4c63d2b9-4356-54db-8cca-17b64c39e42c"
+version = "0.9.15"
+
+[[StructArrays]]
+deps = ["Adapt", "DataAPI", "StaticArrays", "Tables"]
+git-tree-sha1 = "d21f2c564b21a202f4677c0fba5b5ee431058544"
+uuid = "09ab397b-f2b6-538f-b94a-2f83cf4a842a"
+version = "0.6.4"
+
+[[SuiteSparse]]
+deps = ["Libdl", "LinearAlgebra", "Serialization", "SparseArrays"]
+uuid = "4607b0f0-06f3-5cda-b6b1-a6196a1729e9"
+
+[[TOML]]
+deps = ["Dates"]
+uuid = "fa267f1f-6049-4f14-aa54-33bafae1ed76"
+
+[[TableTraits]]
+deps = ["IteratorInterfaceExtensions"]
+git-tree-sha1 = "c06b2f539df1c6efa794486abfb6ed2022561a39"
+uuid = "3783bdb8-4a98-5b6b-af9a-565f29a5fe9c"
+version = "1.0.1"
+
+[[Tables]]
+deps = ["DataAPI", "DataValueInterfaces", "IteratorInterfaceExtensions", "LinearAlgebra", "TableTraits", "Test"]
+git-tree-sha1 = "bb1064c9a84c52e277f1096cf41434b675cd368b"
+uuid = "bd369af6-aec1-5ad0-b16a-f7cc5008161c"
+version = "1.6.1"
+
+[[Tar]]
+deps = ["ArgTools", "SHA"]
+uuid = "a4e569a6-e804-4fa4-b0f3-eef7a1d5b13e"
+
+[[TensorCore]]
+deps = ["LinearAlgebra"]
+git-tree-sha1 = "1feb45f88d133a655e001435632f019a9a1bcdb6"
+uuid = "62fd8b95-f654-4bbd-a8a5-9c27f68ccd50"
+version = "0.1.1"
+
+[[Test]]
+deps = ["InteractiveUtils", "Logging", "Random", "Serialization"]
+uuid = "8dfed614-e22c-5e08-85e1-65c5234f0b40"
+
+[[TiffImages]]
+deps = ["ColorTypes", "DataStructures", "DocStringExtensions", "FileIO", "FixedPointNumbers", "IndirectArrays", "Inflate", "OffsetArrays", "PkgVersion", "ProgressMeter", "UUIDs"]
+git-tree-sha1 = "991d34bbff0d9125d93ba15887d6594e8e84b305"
+uuid = "731e570b-9d59-4bfa-96dc-6df516fadf69"
+version = "0.5.3"
+
+[[TranscodingStreams]]
+deps = ["Random", "Test"]
+git-tree-sha1 = "216b95ea110b5972db65aa90f88d8d89dcb8851c"
+uuid = "3bb67fe8-82b1-5028-8e26-92a6c54297fa"
+version = "0.9.6"
+
+[[URIs]]
+git-tree-sha1 = "97bbe755a53fe859669cd907f2d96aee8d2c1355"
+uuid = "5c2747f8-b7ea-4ff2-ba2e-563bfd36b1d4"
+version = "1.3.0"
+
+[[UUIDs]]
+deps = ["Random", "SHA"]
+uuid = "cf7118a7-6976-5b1a-9a39-7adc72f591a4"
+
+[[Unicode]]
+uuid = "4ec0a83e-493e-50e2-b9ac-8f72acf5a8f5"
+
+[[UnicodeFun]]
+deps = ["REPL"]
+git-tree-sha1 = "53915e50200959667e78a92a418594b428dffddf"
+uuid = "1cfade01-22cf-5700-b092-accc4b62d6e1"
+version = "0.4.1"
+
+[[Unzip]]
+git-tree-sha1 = "34db80951901073501137bdbc3d5a8e7bbd06670"
+uuid = "41fe7b60-77ed-43a1-b4f0-825fd5a5650d"
+version = "0.1.2"
+
+[[Wayland_jll]]
+deps = ["Artifacts", "Expat_jll", "JLLWrappers", "Libdl", "Libffi_jll", "Pkg", "XML2_jll"]
+git-tree-sha1 = "3e61f0b86f90dacb0bc0e73a0c5a83f6a8636e23"
+uuid = "a2964d1f-97da-50d4-b82a-358c7fce9d89"
+version = "1.19.0+0"
+
+[[Wayland_protocols_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "66d72dc6fcc86352f01676e8f0f698562e60510f"
+uuid = "2381bf8a-dfd0-557d-9999-79630e7b1b91"
+version = "1.23.0+0"
+
+[[WoodburyMatrices]]
+deps = ["LinearAlgebra", "SparseArrays"]
+git-tree-sha1 = "de67fa59e33ad156a590055375a30b23c40299d3"
+uuid = "efce3f68-66dc-5838-9240-27a6d6f5f9b6"
+version = "0.5.5"
+
+[[XML2_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Libiconv_jll", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "1acf5bdf07aa0907e0a37d3718bb88d4b687b74a"
+uuid = "02c8fc9c-b97f-50b9-bbe4-9be30ff0a78a"
+version = "2.9.12+0"
+
+[[XSLT_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Libgcrypt_jll", "Libgpg_error_jll", "Libiconv_jll", "Pkg", "XML2_jll", "Zlib_jll"]
+git-tree-sha1 = "91844873c4085240b95e795f692c4cec4d805f8a"
+uuid = "aed1982a-8fda-507f-9586-7b0439959a61"
+version = "1.1.34+0"
+
+[[Xorg_libX11_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libxcb_jll", "Xorg_xtrans_jll"]
+git-tree-sha1 = "5be649d550f3f4b95308bf0183b82e2582876527"
+uuid = "4f6342f7-b3d2-589e-9d20-edeb45f2b2bc"
+version = "1.6.9+4"
+
+[[Xorg_libXau_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "4e490d5c960c314f33885790ed410ff3a94ce67e"
+uuid = "0c0b7dd1-d40b-584c-a123-a41640f87eec"
+version = "1.0.9+4"
+
+[[Xorg_libXcursor_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libXfixes_jll", "Xorg_libXrender_jll"]
+git-tree-sha1 = "12e0eb3bc634fa2080c1c37fccf56f7c22989afd"
+uuid = "935fb764-8cf2-53bf-bb30-45bb1f8bf724"
+version = "1.2.0+4"
+
+[[Xorg_libXdmcp_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "4fe47bd2247248125c428978740e18a681372dd4"
+uuid = "a3789734-cfe1-5b06-b2d0-1dd0d9d62d05"
+version = "1.1.3+4"
+
+[[Xorg_libXext_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libX11_jll"]
+git-tree-sha1 = "b7c0aa8c376b31e4852b360222848637f481f8c3"
+uuid = "1082639a-0dae-5f34-9b06-72781eeb8cb3"
+version = "1.3.4+4"
+
+[[Xorg_libXfixes_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libX11_jll"]
+git-tree-sha1 = "0e0dc7431e7a0587559f9294aeec269471c991a4"
+uuid = "d091e8ba-531a-589c-9de9-94069b037ed8"
+version = "5.0.3+4"
+
+[[Xorg_libXi_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libXext_jll", "Xorg_libXfixes_jll"]
+git-tree-sha1 = "89b52bc2160aadc84d707093930ef0bffa641246"
+uuid = "a51aa0fd-4e3c-5386-b890-e753decda492"
+version = "1.7.10+4"
+
+[[Xorg_libXinerama_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libXext_jll"]
+git-tree-sha1 = "26be8b1c342929259317d8b9f7b53bf2bb73b123"
+uuid = "d1454406-59df-5ea1-beac-c340f2130bc3"
+version = "1.1.4+4"
+
+[[Xorg_libXrandr_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libXext_jll", "Xorg_libXrender_jll"]
+git-tree-sha1 = "34cea83cb726fb58f325887bf0612c6b3fb17631"
+uuid = "ec84b674-ba8e-5d96-8ba1-2a689ba10484"
+version = "1.5.2+4"
+
+[[Xorg_libXrender_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libX11_jll"]
+git-tree-sha1 = "19560f30fd49f4d4efbe7002a1037f8c43d43b96"
+uuid = "ea2f1a96-1ddc-540d-b46f-429655e07cfa"
+version = "0.9.10+4"
+
+[[Xorg_libpthread_stubs_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "6783737e45d3c59a4a4c4091f5f88cdcf0908cbb"
+uuid = "14d82f49-176c-5ed1-bb49-ad3f5cbd8c74"
+version = "0.1.0+3"
+
+[[Xorg_libxcb_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "XSLT_jll", "Xorg_libXau_jll", "Xorg_libXdmcp_jll", "Xorg_libpthread_stubs_jll"]
+git-tree-sha1 = "daf17f441228e7a3833846cd048892861cff16d6"
+uuid = "c7cfdc94-dc32-55de-ac96-5a1b8d977c5b"
+version = "1.13.0+3"
+
+[[Xorg_libxkbfile_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libX11_jll"]
+git-tree-sha1 = "926af861744212db0eb001d9e40b5d16292080b2"
+uuid = "cc61e674-0454-545c-8b26-ed2c68acab7a"
+version = "1.1.0+4"
+
+[[Xorg_xcb_util_image_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_xcb_util_jll"]
+git-tree-sha1 = "0fab0a40349ba1cba2c1da699243396ff8e94b97"
+uuid = "12413925-8142-5f55-bb0e-6d7ca50bb09b"
+version = "0.4.0+1"
+
+[[Xorg_xcb_util_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libxcb_jll"]
+git-tree-sha1 = "e7fd7b2881fa2eaa72717420894d3938177862d1"
+uuid = "2def613f-5ad1-5310-b15b-b15d46f528f5"
+version = "0.4.0+1"
+
+[[Xorg_xcb_util_keysyms_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_xcb_util_jll"]
+git-tree-sha1 = "d1151e2c45a544f32441a567d1690e701ec89b00"
+uuid = "975044d2-76e6-5fbe-bf08-97ce7c6574c7"
+version = "0.4.0+1"
+
+[[Xorg_xcb_util_renderutil_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_xcb_util_jll"]
+git-tree-sha1 = "dfd7a8f38d4613b6a575253b3174dd991ca6183e"
+uuid = "0d47668e-0667-5a69-a72c-f761630bfb7e"
+version = "0.3.9+1"
+
+[[Xorg_xcb_util_wm_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_xcb_util_jll"]
+git-tree-sha1 = "e78d10aab01a4a154142c5006ed44fd9e8e31b67"
+uuid = "c22f9ab0-d5fe-5066-847c-f4bb1cd4e361"
+version = "0.4.1+1"
+
+[[Xorg_xkbcomp_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_libxkbfile_jll"]
+git-tree-sha1 = "4bcbf660f6c2e714f87e960a171b119d06ee163b"
+uuid = "35661453-b289-5fab-8a00-3d9160c6a3a4"
+version = "1.4.2+4"
+
+[[Xorg_xkeyboard_config_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Xorg_xkbcomp_jll"]
+git-tree-sha1 = "5c8424f8a67c3f2209646d4425f3d415fee5931d"
+uuid = "33bec58e-1273-512f-9401-5d533626f822"
+version = "2.27.0+4"
+
+[[Xorg_xtrans_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "79c31e7844f6ecf779705fbc12146eb190b7d845"
+uuid = "c5fb5394-a638-5e4d-96e5-b29de1b5cf10"
+version = "1.4.0+3"
+
+[[Zlib_jll]]
+deps = ["Libdl"]
+uuid = "83775a58-1f1d-513f-b197-d71354ab007a"
+
+[[Zstd_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "cc4bf3fdde8b7e3e9fa0351bdeedba1cf3b7f6e6"
+uuid = "3161d3a3-bdf6-5164-811a-617609db77b4"
+version = "1.5.0+0"
+
+[[isoband_jll]]
+deps = ["Libdl", "Pkg"]
+git-tree-sha1 = "a1ac99674715995a536bbce674b068ec1b7d893d"
+uuid = "9a68df92-36a6-505f-a73e-abb412b6bfb4"
+version = "0.2.2+0"
+
+[[libass_jll]]
+deps = ["Artifacts", "Bzip2_jll", "FreeType2_jll", "FriBidi_jll", "HarfBuzz_jll", "JLLWrappers", "Libdl", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "5982a94fcba20f02f42ace44b9894ee2b140fe47"
+uuid = "0ac62f75-1d6f-5e53-bd7c-93b484bb37c0"
+version = "0.15.1+0"
+
+[[libfdk_aac_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "daacc84a041563f965be61859a36e17c4e4fcd55"
+uuid = "f638f0a6-7fb0-5443-88ba-1cc74229b280"
+version = "2.0.2+0"
+
+[[libpng_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Zlib_jll"]
+git-tree-sha1 = "94d180a6d2b5e55e447e2d27a29ed04fe79eb30c"
+uuid = "b53b4c65-9356-5827-b1ea-8c7a1a84506f"
+version = "1.6.38+0"
+
+[[libvorbis_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Ogg_jll", "Pkg"]
+git-tree-sha1 = "b910cb81ef3fe6e78bf6acee440bda86fd6ae00c"
+uuid = "f27f6e37-5d2b-51aa-960f-b287f2bc3b7a"
+version = "1.3.7+1"
+
+[[nghttp2_jll]]
+deps = ["Artifacts", "Libdl"]
+uuid = "8e850ede-7688-5339-a07c-302acd2aaf8d"
+
+[[p7zip_jll]]
+deps = ["Artifacts", "Libdl"]
+uuid = "3f19e933-33d8-53b3-aaab-bd5110c3b7a0"
+
+[[x264_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "4fea590b89e6ec504593146bf8b988b2c00922b2"
+uuid = "1270edf5-f2f9-52d2-97e9-ab00b5d0237a"
+version = "2021.5.5+0"
+
+[[x265_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg"]
+git-tree-sha1 = "ee567a171cce03570d77ad3a43e90218e38937a9"
+uuid = "dfaa095f-4041-5dcd-9319-2fabd8486b76"
+version = "3.5.0+0"
+
+[[xkbcommon_jll]]
+deps = ["Artifacts", "JLLWrappers", "Libdl", "Pkg", "Wayland_jll", "Wayland_protocols_jll", "Xorg_libxcb_jll", "Xorg_xkeyboard_config_jll"]
+git-tree-sha1 = "ece2350174195bb31de1a63bea3a41ae1aa593b6"
+uuid = "d8fb68d0-12a3-5cfd-a85a-d49703b185fd"
+version = "0.9.1+5"
+"""
+
+# ╔═╡ Cell order:
+# ╟─4b3e86ea-6973-11ec-014f-9f2708ba86cf
+# ╠═2d83c447-1d33-496a-8a39-75d1cb9b2de1
+# ╠═45b4e0ec-5581-4a28-b6c1-c95b8e6a42bb
+# ╟─d3ee4413-c691-4fba-9f91-f24985fb8a88
+# ╠═0a20eddd-24f7-43c6-a0f3-6c1c138fb90a
+# ╟─a455cfa0-ee29-4a4e-8b26-cf91c36985ec
+# ╠═463d18c3-e155-4b73-896f-2bbcdb71bbd2
+# ╟─aea52dd9-7bcc-4873-9332-36b95592b27b
+# ╠═43f97b8d-cd9c-4b8f-8821-68542488e49d
+# ╟─31aeff3d-5083-4c26-a556-847fbe76f9d6
+# ╟─b2084e43-7914-495f-b93e-cf56a87be3c7
+# ╟─59108cf2-d8a5-4c16-b373-bb6a23d13735
+# ╟─ed0a3dc5-99d3-4628-ad5c-7d13e699b353
+# ╟─3c7f1384-33ac-4b2d-9a63-4bf412bfa685
+# ╟─42921538-4ff4-4902-aefa-d958f41d1404
+# ╟─f66956d6-6d0d-42d1-b210-4bdf23ccd0b8
+# ╟─fd14341c-f195-4b86-9f9c-379477eed4af
+# ╠═06983a7b-efca-4167-be5d-a158a4e0858d
+# ╟─ca99ac1a-e4da-41fe-8ab6-834e2b7134b7
+# ╟─e25d53b9-0096-4b6c-85cb-fcae261fabcb
+# ╟─2fbe430d-ab80-406e-aa87-c377d6ed30c2
+# ╠═dba46e66-8704-42de-938c-d576a1336398
+# ╠═e5650185-a6bc-488c-a02b-3c1363c52b8c
+# ╠═b156a4c7-6ed9-4a4d-b3c9-d3c06fbc1faf
+# ╠═c86cc53d-4675-4cd1-af75-ec4a717fd7fa
+# ╠═2e8fb274-0658-43f8-bfa0-40f2f1daf6f3
+# ╠═f4e866fc-8e18-4917-b515-9cc00175a7a4
+# ╟─94691ccf-b1ef-4cc3-8eed-72dd543001f5
+# ╟─32755c53-eefc-4d40-bf60-a8b21a545c6d
+# ╟─00000000-0000-0000-0000-000000000001
+# ╟─00000000-0000-0000-0000-000000000002