Skip to content

Commit

Permalink
Increase genome size.
Browse files Browse the repository at this point in the history
  • Loading branch information
johanneskoester committed Oct 10, 2017
1 parent 6ad74b2 commit 81154bf
Show file tree
Hide file tree
Showing 2 changed files with 3 additions and 3 deletions.
4 changes: 2 additions & 2 deletions .test/ref/annotation.gtf
Original file line number Diff line number Diff line change
@@ -1,2 +1,2 @@
1 example transcript 10 50 . + . gene_id "test"; gene_name "foo";
1 example exon 10 50 . + . gene_id "test"; gene_name "foo";
1 example transcript 100 150 . + . gene_id "test"; gene_name "foo";
1 example exon 110 140 . + . gene_id "test"; gene_name "foo";
2 changes: 1 addition & 1 deletion .test/ref/genome.fasta
Original file line number Diff line number Diff line change
@@ -1,2 +1,2 @@
>1
GCTAGCTCAGAAAAAAAAAAGATGCGAGGCGTAGGCGATGCGATCGATCGATCTATAGGCTCGAGGCTAGGGCTAGCTGA
GGACTGAGCTGAGTACGATCGATCGGAGCTACGAGGCTAGCGAGCTAGCGGATCGAGCGATCTACTATCTACGGCGATCAGCGACTATCTAGCGACTCGCATCTAGCTACCTAGCTCAGAAAAAAAAAAGATGCGAGGCGTAGGCGATGCGATCGATCGATCTATAGGCTCGAGGCTAGGGCTAGCTGA

0 comments on commit 81154bf

Please sign in to comment.