Merge development into master

phac-nml · Jul 19, 2018 · 7b54e91 · 7b54e91
2 parents 6f42299 + 4db3a80
commit 7b54e91
Show file tree

Hide file tree

Showing 14 changed files with 269 additions and 111 deletions.
diff --git a/.travis.yml b/.travis.yml
@@ -5,7 +5,7 @@ python:
 
 env:
   matrix:
-    - "DATABASE_COMMITS='--resfinder-commit dc33e2f9ec2c420f99f77c5c33ae3faa79c999f2 --pointfinder-commit ba65c4d175decdc841a0bef9f9be1c1589c0070a'"
+    - "DATABASE_COMMITS='--resfinder-commit e8f1eb2585cd9610c4034a54ce7fc4f93aa95535 --pointfinder-commit 8706a6363bb29e47e0e398c53043b037c24b99a7'"
 
 install:
   - sudo apt-get update -qq

diff --git a/CHANGELOG.md b/CHANGELOG.md
@@ -1,4 +1,12 @@
-# Version 0.2.0 (in development)
+# Version 0.2.1 (in development)
+
+* Minor
+    * Updating default ResFinder/PointFinder databases to version from July 2018.
+    * Fix regex extracting gene/variant/accession values from ResFinder/PointFinder databases.
+    * Fixing a few entries in table mapping genes to phenotypes.
+    * Print stderr for errors with `makeblastdb`
+
+# Version 0.2.0
 
 * Major
     * Inclusion of predicted resistances to antimicrobial drugs thanks to gene/drug mappings from the NARMS/CIPARS Molecular Working Group. Resistance predictions are microbiological resistances and not clinical resistances (issue #4, #6).

diff --git a/README.md b/README.md
@@ -6,7 +6,7 @@
 
 `staramr` (*AMR) scans bacterial genome contigs against both the [ResFinder][resfinder-db] and [PointFinder][pointfinder-db] databases (used by the [ResFinder webservice][resfinder-web]) and compiles a summary report of detected antimicrobial resistance genes.
 
-**Note: The predicted phenotypes/drug resistances are for microbiological resistance and *not* clinical resistance. This is is provided with support from the NARMS/CIPARS Molecular Working Group and is continually being improved. A small comparison between phenotype/drug resistance predictions produced by `staramr` and those available from NCBI can be found in the [tutorial][tutorial]. We welcome any feedback or suggestions.**
+**Note: The predicted phenotypes/drug resistances are for microbiological resistance and *not* clinical resistance. This is provided with support from the NARMS/CIPARS Molecular Working Group and is continually being improved. A small comparison between phenotype/drug resistance predictions produced by `staramr` and those available from NCBI can be found in the [tutorial][tutorial]. We welcome any feedback or suggestions.**
 
 For example:
 
@@ -54,6 +54,11 @@ staramr search -o out --pointfinder-organism salmonella *.fasta
   * [Latest Code](#latest-code)
   * [Dependencies](#dependencies)
 - [Output](#output)
+  * [summary.tsv](#summarytsv)
+  * [resfinder.tsv](#resfindertsv)
+  * [pointfinder.tsv](#pointfindertsv)
+  * [settings.txt](#settingstxt)
+  * [hits/](#hits)
 - [Tutorial](#tutorial)
 - [Usage](#usage)
   * [Main Command](#main-command)
@@ -177,8 +182,8 @@ source .venv/bin/activate
 # Install staramr. Use '-e' to update the install on code changes.
 pip install -e .
 
-# Now run `starmr`
-starmr 
+# Now run `staramr`
+staramr 
 ```
 
 Due to the way I package the ResFinder/PointFinder databases, the development code will not come with a default database.  You must first build the database before usage. E.g.
@@ -203,8 +208,116 @@ There are 5 different output files produced by `staramr`:
 4. `settings.txt`: The command-line, database versions, and other settings used to run `staramr`.
 5. `results.xlsx`: An Excel spreadsheet containing the previous 4 files as separate worksheets.
 
-In addition, the directory `hits/` stores fasta files of the specific blast hits. 
+In addition, the directory `hits/` stores fasta files of the specific blast hits.
 
+## summary.tsv
+
+The **summary.tsv** output file generated by `staramr` contains the following columns:
+
+* __Isolate ID__: The id of the isolate/genome file(s) passed to `staramr`.
+* __Genotype__: The AMR genotype of the isolate.
+* __Predicted Phenotype__: The predicted AMR phenotype (drug resistances) for the isolate.
+
+### Example
+
+| Isolate ID | Genotype                                                  | Predicted Phenotype                                                                                       |
+|------------|-----------------------------------------------------------|-----------------------------------------------------------------------------------------------------------|
+| SRR1952908 | aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) | streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline |
+| SRR1952926 | blaTEM-57, gyrA (S83Y), tet(A)                            | ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline                                               |
+
+## resfinder.tsv
+
+The **resfinder.tsv** output file generated by `staramr` contains the following columns:
+
+* __Isolate ID__: The id of the isolate/genome file(s) passed to `staramr`.
+* __Gene__: The particular AMR gene detected.
+* __Predicted Phenotype__: The predicted AMR phenotype (drug resistances) for this gene.
+* __%Identity__: The % identity of the top BLAST HSP to the AMR gene.
+* __%Overlap__: THe % overlap of the top BLAST HSP to the AMR gene (calculated as __hsp length/total length * 100__).
+* __HSP Length/Total Length__ The top BLAST HSP length over the AMR gene total length (nucleotides).
+* __Contig__: The contig id containing this AMR gene.
+* __Start__: The start of the AMR gene (will be greater than __End__ if on minus strand).
+* __End__: The end of the AMR gene.
+* __Accession__: The accession of the AMR gene in the ResFinder database.
+
+### Example
+
+| Isolate ID | Gene       | Predicted Phenotype  | %Identity  | %Overlap  | HSP Length/Total Length  | Contig       | Start  | End   | Accession |
+|------------|------------|----------------------|------------|-----------|--------------------------|--------------|--------|-------|-----------|
+| SRR1952908 | sul3       | sulfisoxazole        | 100.00     | 100.00    | 792/792                  | contig00030  | 2091   | 2882  | AJ459418  |
+| SRR1952908 | tet(A)     | tetracycline         | 99.92      | 100.00    | 1200/1200                | contig00032  | 1551   | 2750  | AJ517790  |
+
+## pointfinder.tsv
+
+The **pointfinder.tsv** output file generated by `staramr` contains the following columns:
+
+* __Isolate ID__: The id of the isolate/genome file(s) passed to `staramr`.
+* __Gene__: The particular AMR gene detected, with the point mutation within *()*.
+* __Predicted Phenotype__: The predicted AMR phenotype (drug resistances) for this gene.
+* __Type__: The type of this mutation from PointFinder (either **codon** or **nucleotide**).
+* __Position__: The position of the mutation. For **codon** type, the position is the codon number in the gene, for **nucleotide** type it is the nucleotide number.
+* __Mutation__: The particular mutation. For **codon** type lists the codon mutation, for **nucleotide** type lists the single nucleotide mutation.
+* __%Identity__: The % identity of the top BLAST HSP to the AMR gene.
+* __%Overlap__: The % overlap of the top BLAST HSP to the AMR gene (calculated as __hsp length/total length * 100__).
+* __HSP Length/Total Length__ The top BLAST HSP length over the AMR gene total length (nucleotides).
+* __Contig__: The contig id containing this AMR gene.
+* __Start__: The start of the AMR gene (will be greater than __End__ if on minus strand).
+* __End__: The end of the AMR gene.
+
+### Example
+
+| Isolate ID  | Gene         | Predicted Phenotype                | Type   | Position  | Mutation             | %Identity  | %Overlap  | HSP Length/Total Length  | Contig       | Start   | End    |
+|-------------|--------------|------------------------------------|--------|-----------|----------------------|------------|-----------|--------------------------|--------------|---------|--------|
+| SRR1952908  | gyrA (S83Y)  | ciprofloxacin I/R, nalidixic acid  | codon  | 83        | TCC -> TAC (S -> Y)  | 99.96      | 100.00    | 2637/2637                | contig00008  | 22801   | 20165  |
+| SRR1952926  | gyrA (S83Y)  | ciprofloxacin I/R, nalidixic acid  | codon  | 83        | TCC -> TAC (S -> Y)  | 99.96      | 100.00    | 2637/2637                | contig00011  | 157768  | 160404 |
+
+## settings.txt
+
+The **settings.txt** file contains the particular settings used to run `staramr`.
+
+* __command_line__: The command line used to run `staramr`.
+* __version__: The version of `staramr`.
+* __start_time__,__end_time__,__total_minutes__: The start, end, and duration for running `staramr`.
+* __resfinder_db_dir__, __pointfinder_db_dir__: The directory containing the ResFinder and PointFinder databases.
+* __resfinder_db_url__, __pointfinder_db_url__: The URL to the git repository for the ResFinder and PointFinder databases.
+* __resfinder_db_commit__, __pointfinder_db_commit__: The git commit ids for the ResFinder and PointFinder databases.
+* __resfinder_db_date__, __pointfinder_db_date__: The date of the git commits of the ResFinder and PointFinder databases.
+* __pointfinder_gene_drug_version__, __resfinder_gene_drug_version__: A version identifier for the gene/drug mapping table used by `staramr`.
+
+### Example
+
+```
+command_line                  = staramr search -o out --pointfinder-organism salmonella SRR1952908.fasta SRR1952926.fasta
+version                       = 0.2.0
+start_time                    = 2018-06-08 10:28:47
+end_time                      = 2018-06-08 10:28:59
+total_minutes                 = 0.20
+resfinder_db_dir              = staramr/databases/data/dist/resfinder
+resfinder_db_url              = https://bitbucket.org/genomicepidemiology/resfinder_db.git
+resfinder_db_commit           = dc33e2f9ec2c420f99f77c5c33ae3faa79c999f2
+resfinder_db_date             = Tue, 20 Mar 2018 16:49
+pointfinder_db_dir            = staramr/databases/data/dist/pointfinder
+pointfinder_db_url            = https://bitbucket.org/genomicepidemiology/pointfinder_db.git
+pointfinder_db_commit         = ba65c4d175decdc841a0bef9f9be1c1589c0070a
+pointfinder_db_date           = Fri, 06 Apr 2018 09:02
+pointfinder_gene_drug_version = 050218
+resfinder_gene_drug_version   = 050218
+```
+
+## hits/
+
+The **hits/** directory contains the BLAST HSP nucleotides for the entries listed in the **resfinder.tsv** and **pointfinder.tsv** files. There are up to two files per input genome, one for ResFinder and one for PointFinder.
+
+For example, with an input genome named **SRR1952908.fasta** there would be two files `hits/resfinder_SRR1952908.fasta` and `hits/pointfinder_SRR1952908.fasta`. These files contain mostly the same information as in the **resfinder.tsv** and **pointfinder.tsv** files. Additional information is the **resistance_gene_start** and **resistance_gene_end** listing the start/end of the BLAST HSP on the AMR resistance gene from the ResFinder/PointFinder databases. 
+
+### Example
+
+```
+>aadA1_3_JQ414041 isolate: SRR1952908, contig: contig00030, contig_start: 5355, contig_end: 4564, resistance_gene_start: 1, resistance_gene_end: 792, hsp/length: 792/792, pid: 100.00%, plength: 100.00%
+ATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATC
+GAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGC
+...
+```
 
 # Tutorial
 
@@ -445,4 +558,4 @@ specific language governing permissions and limitations under the License.
 [pypi-staramr]: https://pypi.org/project/staramr/
 [bioconda]: https://bioconda.github.io/
 [card-web]: https://card.mcmaster.ca/
-[tutorial]: doc/tutorial/staramr-tutorial.ipynb
+[tutorial]: doc/tutorial/staramr-tutorial.ipynb