rna-pdb-tools

Beta: this is still under development. Contact me if you need help. We'll be adding features and possibly making breaking changes in future releases.

Look for other our projects at https://github.com/RNA-Puzzles.

Magnus, Marcin. (2016). rna-pdb-tools. Zenodo. 10.5281/zenodo.60933

If you find the tools helpful, you can cite the repo using the doi above :-), you can donate via PayPal, and if you like the project, please "Star it", so it would be easier to find it for others and to make me happy that the toolbox useful not only for me.

A core library and a set of programs to run various Python functions related to work with PDB files of RNA structures.

The software is used by me in my servers NPDock (RNA/DNA-protein docking method, http://genesilico.pl/NPDock/) and SimRNAweb (RNA 3D structure prediction method, http://iimcb.genesilico.pl/SimRNAweb/) and mqapRNA (RNA 3D quality control, http://iimcb.genesilico.pl/mqapRNA/).

What is fun here?

rna-pdb-tools is a packages of shell utils that are using the common core library. You can also access functions of the library from your scripts.

A shell util:

$ rna_pdb_toolsx.py --is_pdb input/1I9V_A.pdb
True
$ rna_pdb_toolsx.py --is_pdb input/image.png
False

or from a script

>>> from rna_pdb_tools_lib import *
>>> s = RNAStructure('input/1I9V_A.pdb')
>>> s.is_pdb()
True

or from another script (fetch an alignment and plot it)

Fig. See more https://github.com/mmagnus/rna-pdb-tools/blob/master/rna_pdb_tools/utils/rna_alignment/rna_alignment.ipynb

Take a tour http://mmagnus.github.io/rna-pdb-tools/#/ and/or read the doc rna-pdb-tools.rtfd.io/en/latest/.

Fig. rna_pdb_toolsx.py --get_rnapuzzle_ready *pdb --inplace

Table of Contents

• Tour
• rna_pdb_toolsx.py
• Utils
• Docs
• RNA Puzzle Submission
• Inspiration (and alternatives)
• Install

Tour

Take a tour http://mmagnus.github.io/rna-pdb-tools/#/

rna_pdb_toolsx.py

[mm] rna_pdb_tools$ git:(master) ✗ ./rna_pdb_toolsx.py -h
usage: rna_pdb_toolsx.py [-h] [--version] [-r] [-c] [--is_pdb] [--is_nmr]
                         [--un_nmr] [--orgmode] [--get_chain GET_CHAIN]
                         [--fetch] [--fetch_ba] [--get_seq] [--get_ss]
                         [--rosetta2generic] [--get_rnapuzzle_ready] [--rpr]
                         [--no_hr] [--renumber_residues]
                         [--dont_rename_chains] [--dont_fix_missing_atoms]
                         [--dont_report_missing_atoms] [--collapsed_view]
                         [--cv] [-v] [--replace_hetatm] [--inplace]
                         [--mutate MUTATE] [--edit EDIT]
                         [--replace-chain REPLACE_CHAIN] [--delete DELETE]
                         [--extract EXTRACT]
                         file [file ...]

rna_pdb_tools - a swiss army knife to manipulation of RNA pdb structures

Tricks:

   for i in *pdb; do rna_pdb_toolsx.py --get_rnapuzzle_ready $i >  ${i/.pdb/_rpr.pdb}; done

Usage::

   $ for i in *pdb; do rna_pdb_toolsx.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

    $ rna_pdb_toolsx.py --get_seq *
    # BujnickiLab_RNApuzzle14_n01bound
    > A:1-61
    # BujnickiLab_RNApuzzle14_n02bound
    > A:1-61
    CGUUAGCCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAGCAACGCG
    [...]

positional arguments:
  file                  file

optional arguments:
  -h, --help            show this help message and exit
  --version
  -r, --report          get report
  -c, --clean           get clean structure
  --is_pdb              check if a file is in the pdb format
  --is_nmr              check if a file is NMR-style multiple model pdb
  --un_nmr              Split NMR-style multiple model pdb files into
                        individual models [biopython]
  --orgmode             get a structure in org-mode format <sick!>
  --get_chain GET_CHAIN
                        get chain, .e.g A
  --fetch               fetch file from the PDB db
  --fetch_ba            fetch biological assembly from the PDB db
  --get_seq             get seq
  --get_ss              get secondary structure
  --rosetta2generic     convert ROSETTA-like format to a generic pdb
  --get_rnapuzzle_ready
                        get RNApuzzle ready (keep only standard atoms).Be
                        default it does not renumber residues, use
                        --renumber_residues [requires biopython]
  --rpr                 alias to get_rnapuzzle ready)
  --no_hr               do not insert the header into files
  --renumber_residues   by defult is false
  --dont_rename_chains  used only with --get_rnapuzzle_ready. By default
                        --get_rnapuzzle_ready rename chains from ABC.. to stop
                        behavior switch on this option
  --dont_fix_missing_atoms
                        used only with --get_rnapuzzle_ready
  --dont_report_missing_atoms
                        used only with --get_rnapuzzle_ready
  --collapsed_view
  --cv                  alias to collapsed_view
  -v, --verbose         tell me more what you're doing, please!
  --replace_hetatm      replace 'HETATM' with 'ATOM' [tested only with
                        --get_rnapuzzle_ready]
  --inplace             in place edit the file! [experimental, only for
                        get_rnapuzzle_ready, delete, get_ss, get_seq]
  --mutate MUTATE       mutate residues, e.g. A:1A+2A+3A+4A,B:1A to mutate the
                        first nucleotide of the A chain to Adenine etc and the
                        first nucleotide of the B chain
  --edit EDIT           edit 'A:6>B:200', 'A:2-7>B:2-7'
  --replace-chain REPLACE_CHAIN
                        a file PDB name with one chain that will be used to
                        replace the chain in the original PDB file, the chain
                        id in this file has to be the same with the chain id
                        of the original chain
  --delete DELETE       delete the selected fragment, e.g. A:10-16, or for
                        more than one fragment --delete 'A:1-25+30-57'
  --extract EXTRACT     extract the selected fragment, e.g. A:10-16, or for
                        more than one fragment --extract 'A:1-25+30-57'

Tricks:

$ for i in *; do echo $i; rna_pdb_toolsx.py --delete A:48-52 $i > noloop/${i/.pdb/_noloop.pdb}; done
10_rp17c.out.14.pdb
10_rp17c.out.14_out.pdb
[..]

$ for i in *.pdb; do rna_pdb_toolsx.py --c $i > ${i/.pdb/_clx.pdb}; done

$ for i in *.pdb; do rna_pdb_toolsx.py --get_rnapuzzle_ready $i > ${i/.pdb/_rpr.pdb}; done

.. keep original structures in original and use rpr:

➜  bujnicki_server_ss for i in original/*.pdb; do rna_pdb_toolsx.py --get_rnapuzzle_ready $i > ${i/.pdb/_rpr.pdb}; done
➜  bujnicki_server_ss ls
17pz_withSS_all_thrs6.00A_clust01-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust06-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust02-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust07-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust03-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust08-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust04-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust09-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust05-000001_AA_rpr.pdb original

.. or to get SimRNAready structures:

$ for i in *pdb; do rna_pdb_toolsx.py --get_simrna_ready $i >  ${i/.pdb/_srr.pdb}; done

Utils

See Utils for simple but still extremly powerful rna tools.

Read more http://rna-pdb-tools.readthedocs.io/en/latest/

Docs

Read the documentations at rna-pdb-tools.rtfd.io/en/latest/.

RNA Puzzle Submission

Read at https://rna-pdb-tools.readthedocs.io/en/latest/rna-puzzles.html

Inspiration (and alternatives)

• https://www.rosettacommons.org/docs/latest/application_documentation/rna/RNA-tools
• http://blue11.bch.msu.edu/mmtsb/convpdb.pl
• https://github.com/haddocking/pdb-tools
• https://github.com/harmslab/pdbtools
• http://ginsberg.med.virginia.edu/Links/Phenix/pdbtools.htm
• .. and more!

Install

Read at http://rna-pdb-tools.readthedocs.io/en/latest/install.html